Cart 9 Product Products 1 077,30 € (empty)
-
1 x KHK-ketohe...121,50 € -
1 x ZNF446-zin...121,50 € -
1 x PARK2-Park...121,50 € -
1 x IL33-inter...121,50 € -
1 x KLK15-kall...113,40 € -
1 x PLVAP-plas...121,50 € -
1 x LSM14A-LSM...121,50 € -
1 x STAT5B-sig...121,50 € -
1 x HIST1H4F-h...113,40 €
No products
To be determined Shipping
1 077,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 077,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 077,30 €
View larger 
YES1-v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 Gene
PTXBC048960
New product
Data sheet of YES1-v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about YES1-v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC048960 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | YES1 |
| Origin species: | Human |
| Product name: | YES1-v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 Gene |
| Size: | 2ug |
| Accessions: | BC048960 |
| Gene id: | 7525 |
| Gene description: | v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 |
| Synonyms: | YES1 proto-oncogene, Src family tyrosine kinase; HsT441; P61-YES; Yes; c-yes; tyrosine-protein kinase Yes; Yamaguchi sarcoma oncogene; cellular yes-1 protein; proto-oncogene c-Yes; proto-oncogene tyrosine-protein kinase YES; v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1; YES proto-oncogene 1, Src family tyrosine kinase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctgcattaaaagtaaagaaaacaaaagtccagccattaaatacagacctgaaaatactccagagcctgtcagtacaagtgtgagccattatggagcagaacccactacagtgtcaccatgtccgtcatcttcagcaaagggaacagcagttaatttcagcagtctttccatgacaccatttggaggatcctcaggggtaacgccttttggaggtgcatcttcctcattttcagtggtgccaagttcatatcctgctggtttaacaggtggtgttactatatttgtggccttatatgattatgaagctagaactacagaagacctttcatttaagaagggtgaaagatttcaaataattaacaatacggaaggagattggtgggaagcaagatcaatcgctacaggaaagaatggttatatcccgagcaattatgtagcgcctgcagattccattcaggcagaagaatggtattttggcaaaatggggagaaaagatgctgaaagattacttttgaatcctggaaatcaacgaggtattttcttagtaagagagagtgaaacaactaaaggtgcttattccctttctattcgtgattgggatgagataaggggtgacaatgtgaaacactacaaaattaggaaacttgacaatggtggatactatatcacaaccagagcacaatttgatactctgcagaaattggtgaaacactacacagaacatgctgatggtttatgccacaagttgacaactgtgtgtccaactgtgaaacctcagactcaaggtctagcaaaagatgcttgggaaatccctcgagaatctttgcgactagaggttaaactaggacaaggatgtttcggcgaagtgtggatgggaacatggaatggaaccacgaaagtagcaatcaaaacactaaaaccaggtacaatgatgccagaagctttccttcaagaagctcagataatgaaaaaattaagacatgataaacttgttccactatatgctgttgtttctgaagaaccaatttacattgtcactgaatttatgtcaaaaggaagcttattagatttccttaaggaaggagatggaaagtatttgaagcttccacagctggttgatatggctgctcagattgctgatggtatggcatatattgaaagaatgaactatattcaccgagatcttcgggctgctaatattcttgtaggagaaaatcttgtgtgcaaaatagcagactttggtttagcaaggttaattgaagacaatgaatacacagcaagacaaggtgcaaaatttccaatcaaatggacagctcctgaagctgcactgtatggtcggtttacaataaagtctgatgtctggtcatttggaattctgcaaacagaactagtaacaaagggccgagtgccatatccaggtatggtgaaccgtgaagtactagaacaagtggagcgaggatacaggatgccgtgccctcagggctgtccagaatccctccatgaattgatgaatctgtgttggaagaaggaccctgatgaaagaccaacatttgaatatattcagtccttcttggaagactacttcactgctacagagccacagtaccagccaggagaaaatttataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C1q and tumor necrosis factor related protein 9 - sphingomyelin phosphodiesterase 1, acid lysosomal - major facilitator superfamily domain containing 1 - family with sequence similarity 114, member A1 |