Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
C1QTNF9-C1q and tumor necrosis factor related protein 9 Gene
PTXBC040438
New product
Data sheet of C1QTNF9-C1q and tumor necrosis factor related protein 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1QTNF9-C1q and tumor necrosis factor related protein 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040438 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1QTNF9 |
| Origin species: | Human |
| Product name: | C1QTNF9-C1q and tumor necrosis factor related protein 9 Gene |
| Size: | 2ug |
| Accessions: | BC040438 |
| Gene id: | 338872 |
| Gene description: | C1q and tumor necrosis factor related protein 9 |
| Synonyms: | AQL1; C1QTNF9A; CTRP9; complement C1q and tumor necrosis factor-related protein 9A; complement C1q and tumor necrosis factor-related protein 9; complement C1q tumor necrosis factor-related protein 9; complement C1q tumor necrosis factor-related protein 9A; C1q and tumor necrosis factor related protein 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggatctggtggcttctgcttgccattgaaatctgcacagggaacataaactcacaggacacctgcaggcaagggcaccctggaatccctgggaaccccggtcacaatggtctgcctggaagagatggacgagacggagcgaagggtgacaaaggcgatgcaggagaaccaggacgtcctggcagcccggggaaggatgggacgagtggagagaagggagaacgaggagcagatggaaaagttgaagcaaaaggcatcaaaggtgatcaaggctcaagaggatccccaggaaaacatggccccaaggggcttgcagggcccatgggagagaaaggcctccgaggagagactgggcctcaggggcagaaggggaataagggtgacgtgggtcccactggtcctgaggggccaaggggcaacattgggcctttgggcccaactggtttaccgggccccatgggccctattggaaagcctggtcccaagggagaagctggacccacggggccccagggtgagccaggagtccggggaataagaggctggaaaggagatcgaggagagaaagggaaaatcggtgagactctagtcttgccaaaaagtgctttcactgtggggctcacggtgctgagcaagtttccttcttcagatgtgcccattaaatttgataagatcctgtataacgaattcaaccattatgatacagcagcggggaaattcacgtgccacattgctggggtctattacttcacctaccacatcactgttttctccaggaatgttcaggtgtctttggtcaaaaatggagtaaaaatactgcacaccaaagatgcttacatgagctctgaggaccaggcctctggcggcattgtcctgcagctgaagctcggggatgaggtgtggctgcaggtgacaggaggagagaggttcaatggcttgtttgctgatgaggacgatgacacaactttcacagggttccttctgttcagcagcccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sphingomyelin phosphodiesterase 1, acid lysosomal - major facilitator superfamily domain containing 1 - family with sequence similarity 114, member A1 - caspase 10, apoptosis-related cysteine peptidase |