Cart 5 Product Products 575,10 € (empty)
-
1 x HLA-DQB1-m...113,40 € -
1 x UBE2V2-ubi...113,40 € -
1 x ZDHHC8P-zi...113,40 € -
1 x CALM1-calm...113,40 € -
1 x LUC7L-LUC7...121,50 €
No products
To be determined Shipping
575,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 575,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 575,10 €
View larger 
SLC5A10-solute carrier family 5 (sodium/glucose cotransporter), member 10 Gene
PTXBC039868
New product
Data sheet of SLC5A10-solute carrier family 5 (sodium/glucose cotransporter), member 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC5A10-solute carrier family 5 (sodium/glucose cotransporter), member 10 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC039868 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC5A10 |
| Origin species: | Human |
| Product name: | SLC5A10-solute carrier family 5 (sodium/glucose cotransporter), member 10 Gene |
| Size: | 2ug |
| Accessions: | BC039868 |
| Gene id: | 125206 |
| Gene description: | solute carrier family 5 (sodium/glucose cotransporter), member 10 |
| Synonyms: | SGLT-5; SGLT5; sodium/glucose cotransporter 5; Na(+)/glucose cotransporter 5; solute carrier family 5 (sodium/glucose cotransporter), member 10; solute carrier family 5 (sodium/sugar cotransporter), member 10; solute carrier family 5 member 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgtggtggccgattggagcctccctcttcgccagcagcgagggctctggcctcttcattggactggcgggctcaggcgcggcaggaggtctggccgtggcaggcttcgagtggaatgccacgtacgtgctgctggcactggcatgggtgttcgtgcccatctacatctcctcagagatcgtcaccttacctgagtacattcagaagcgctacgggggccagcggatccgcatgtacctgtctgtcctgtccctgctactgtctgtcttcaccaagatatcgctggacctgtacgcgggggctctgtttgtgcacatctgcctgggctggaacttctacctctccaccatcctcacgctcggcatcacagccctgtacaccatcgcagcttttgaccagatcggtggttacgggcagctggaggcagcctacgcccaggccattccctccaggaccattgccaacaccacctgccacctgccacgtacagacgccatgcacatgtttcgagacccccacacaggggacctgccgtggaccgggatgacctttggcctgaccatcatggccacctggtactggtgcaccgaccaggtcatcgtgcagcgatcactgtcagcccgggacctgaaccatgccaaggcgggctccatcctggccagctacctcaagatgctccccatgggcctgatcatcatgccgggcatgatcagccgcgcattgttcccaggtgctcatgtctatgaggagagacaccaagtgtccgtctctcgaacagatgatgtgggctgcgtggtgccgtccgagtgcctgcgggcctgcggggccgaggtcggctgctccaacatcgcctaccccaagctggtcatggaactgatgcccatcggtctgcgggggctgatgatcgcagtgatgctggcggcgctcatgtcgtcgctgacctccatcttcaacagcagcagcaccctcttcactatggacatctggaggcggctgcgtccccgctccggcgagcgggagctcctgctggtgggacgcactgggataccctcaacacccccagcccctcaaagccgtctcagcttcctcctgcccgaaacaccaccattggagcggtatctcctaggcctcgtggtcatggatctctggctggtcatagtggcactcatcggcgtgagtgtggcctggatccccgtcctgcaggactccaacagcgggcaactcttcatctacatgcagtcagtgaccagctccctggccccaccagtgactgcagtctttgtcctgggcgtcttctggcgacgtgccaacgagcagggggccttctggggcctgatagcagggctggtggtgggggccacgaggctggtcctggaattcctgaacccagccccaccgtgcggagagccagacacgcggccagccgtcctggggagcatccactacctgcacttcgctgtcgccctctttgcactcagtggtgctgttgtggtggctggaagcctgctgaccccacccccacagagtgtccagattgagaaccttacctggtggaccctggctcaggatgtgcccttgggaactaaagcaggtgatggccaaacaccccagaaacacgccttctgggcccgtgtctgtggcttcaatgccatcctcctcatgtgtgtcaacatattcttttatgcctacttcgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 - BTB and CNC homology 1, basic leucine zipper transcription factor 1 - solute carrier family 5 (sodium/glucose cotransporter), member 11 - potassium voltage-gated channel, shaker-related subfamily, member 2 |