Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C10orf107-chromosome 10 open reading frame 107 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C10orf107-chromosome 10 open reading frame 107 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041932 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C10orf107 |
| Origin species: | Human |
| Product name: | C10orf107-chromosome 10 open reading frame 107 Gene |
| Size: | 2ug |
| Accessions: | BC041932 |
| Gene id: | 219621 |
| Gene description: | chromosome 10 open reading frame 107 |
| Synonyms: | uncharacterized protein C10orf107; bA63A2.1; chromosome 10 open reading frame 107 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatttctctattattcagtattcaaaatttatgactttactagctatgtcacttcaaaatcttaaaacactacatatgtccttagaggaaagcataaaatggcttggagaagttatggctgaaataggaccaacacattcgcaaaagagtgaggactggaatatctttgatgtaaaacaagccaatgctatcattgattacttaaaaatcagcttatttcaacactacaagctatacgagtttatgttctactctgccagggaagaaattgtgataggaactgagcaagtgatagaggttgtcaagtctgcatgtggccctttcccaaatcctctggaagaaggaatctcatttgatatttattcaacattcatagagccccccacaatattggatacggaaatgaagaggttggatcaagaacaaggccctgaggagtctcagccagaaactgacacctcagacatggatcctttagttggtttcaccattgaagatgtaaaatcagtgctggatcaagtcacagatgacattttaatcggcattcagaccgagataaacgaaaaactgcaaatacaggaagaggcctttaatgcacgaatagaaaaattgaaaaaggcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DiGeorge syndrome critical region gene 2 - adhesion molecule with Ig-like domain 2 - similar to 60S ribosomal protein L21 - additional sex combs like 2 (Drosophila) |