Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LOC402176-similar to 60S ribosomal protein L21 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC402176-similar to 60S ribosomal protein L21 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057822 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC402176 |
| Origin species: | Human |
| Product name: | LOC402176-similar to 60S ribosomal protein L21 Gene |
| Size: | 2ug |
| Accessions: | BC057822 |
| Gene id: | 402176 |
| Gene description: | similar to 60S ribosomal protein L21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacttgttcctttggttacaaatatgcgaatctataagaaaggtgatatggtacacatcaacggaatggatactgttcaaaaaggaatgccccacaagtgttaccatggcaaaactgaaagtctacagtgttccccagcatgctgttggcattgttgtaaacaagggtaagattcttgccaagagaattaatgtgcatattgagcacattaagcactgtaagagccgagatagcttcctgaaatgtgtgaaggaaaatgatcagaaaaagaaagaagccaaagaggaaggtacctgggttcaagtgaagcaccagcctgctccacccagagaagcgcactttgtgaaagcttgtgggaaggagcctgagctgctggaacctattccctgtgaattcatggcatcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - additional sex combs like 2 (Drosophila) - cadherin 2, type 1, N-cadherin (neuronal) - retinaldehyde binding protein 1-like 1 - D4, zinc and double PHD fingers, family 3 |