Cart 7 Product Products 1 612,17 € (empty)
-
![DBU, 1,8-Diazabicyclo[5.4.0]undec-7-ene](https://www.proteogenix-products.com/571496-cart_default/dbu-18-diazabicyclo-540-undec-7-ene.jpg)
-
1 x KRT8-kerat...121,50 € -
1 x DTNBP1-dys...121,50 € -
1 x GCM1-glial...121,50 € -
-
-
1 x Goat...677,00 €
No products
To be determined Shipping
1 612,17 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 612,17 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 612,17 €
Data sheet of RNF144B-ring finger 144B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF144B-ring finger 144B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063311 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF144B |
| Origin species: | Human |
| Product name: | RNF144B-ring finger 144B Gene |
| Size: | 2ug |
| Accessions: | BC063311 |
| Gene id: | 255488 |
| Gene description: | ring finger 144B |
| Synonyms: | E3 ubiquitin-protein ligase RNF144B; IBRDC2; PIR2; bA528A10.3; IBR domain containing 2; IBR domain-containing protein 2; p53-inducible RING finger protein; ring finger protein 144B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctcagctggtaggctccactatctcgccatgactgctgaaaatcccactcctggagacctggctccggcccccctcatcacttgcaaactctgcctgtgtgagcagtctctggacaagatgaccacactccaggaatgccagtgcatcttttgcacagcttgcctgaaacagtacatgcagctggcaatccgagaaggatgtgggtctcccatcacttgccctgacatggtgtgcctaaaccacgggaccctgcaggaagctgagattgcctgtttggtacctgtggaccagtttcaactttatcagaggttaaaatttgaaagagaagttcatctggacccctaccgaacatggtgtcctgttgcagactgtcagacagtgtgccctgttgcctcgagtgacccaggacagcctgtgctggtggaatgcccttcttgccacctgaaattctgctcgtgttgcaaggatgcttggcatgcagaggtctcctgtagagacagtcagcctattgtcctgccaacagagcaccgagccctctttgggacagatgcagaagcccccattaagcagtgcccagtttgccgggtttatatcgaacgcaatgaaggctgcgctcagatgatgtgcaaaaactgcaagcatacattttgctggtactgccttcagaacttggataatgacattttcctcagacattatgacaaagggccatgcaggaataaacttggccactcaagagcatcagtgatgtggaaccgaacacaggtggtggggattctcgtaggcttgggcatcattgccttggttacttcccccttactcctggcctccccatgtataatctgttgtgtctgcaagtcctgtcggggcaagaagaaaaagcacgacccatccacaacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carboxypeptidase A5 - lipase, endothelial - carboxypeptidase A5 - selenoprotein W, 1 |