Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CIB2-calcium and integrin binding family member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CIB2-calcium and integrin binding family member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047381 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CIB2 |
| Origin species: | Human |
| Product name: | CIB2-calcium and integrin binding family member 2 Gene |
| Size: | 2ug |
| Accessions: | BC047381 |
| Gene id: | 10518 |
| Gene description: | calcium and integrin binding family member 2 |
| Synonyms: | DFNB48; KIP2; USH1J; calcium and integrin-binding family member 2; DNA-dependent protein kinase catalytic subunit-interacting protein 2; calcium and integrin binding family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaacaagcagaccatcttcaccgaagagcagctagacaactaccaggactgcaccttcttcaataagaaggacatcctcaagctgcattcgcgattctatgagctggcccccaacctcgtcccaatggactacaggaagagccccatcgtccacgtgcccatgagcctcatcatccagatgccagagctccgggagaatcccttcaaagaaaggatcgtggcggcgttttccgaggatggtgaggggaacctcactttcaacgactttgtggacatgttttccgtgctctgcgagtcggctccccgagagctcaaggcaaactatgccttcaagatctatgacttcaacactgacaacttcatctgcaaggaggacctggagctgacgctggcccggctcactaagtcagagctggatgaggaggaggtggtgcttgtgtgcgacaaggtcattgaggaggctgacttggatggtgacggcaagctgggctttgctgacttcgaggacatgattgccaaggcccctgacttcctcagcactttccacatccggatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heat shock transcription factor, Y-linked 1 - glutamate-cysteine ligase, catalytic subunit - proline rich Gla (G-carboxyglutamic acid) 1 - Morf4 family associated protein 1-like 1 |