Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene
PTXBC038092
New product
Data sheet of ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038092 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5H |
| Origin species: | Human |
| Product name: | ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene |
| Size: | 2ug |
| Accessions: | BC038092 |
| Gene id: | 10476 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d |
| Synonyms: | ATPQ; ATP synthase subunit d, mitochondrial; ATP synthase D chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d; ATP synthase, H+ transporting, mitochondrial F1F0, subunit d; ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d; ATPase subunit d; My032 protein; ATP synthase, H+ transporting, mitochondrial Fo complex subunit D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgggcgaaaacttgctctaaaaaccattgactgggtagcttttgcagagatcataccccagaaccaaaaggccattgctagttccctgaaatcctggaatgagaccctcacctccaggttggctgctttacctgagaatccaccagctatcgactgggcttactacaaggccaatgtggccaaggctggcttggtggatgactttgagaagaagtttaatgcgctgaaggttcccgtgccagaggataaatatactgcccaggtggatgccgaagaaaaagaagatgtgaaatcttgtgctgagtgggtgtctctctcaaaggccaggattgtagaatatgagaaagagatggagaagatgaagaacttaattccatttgatcagatgaccattgaggacttgaatgaagctttcccagaaaccaaattagacaagaaaaagtatccctattggcctcaccaaccaattgagaatttataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), alpha z polypeptide - solute carrier family 36 (proton/amino acid symporter), member 4 - required for meiotic nuclear division 5 homolog A (S. cerevisiae) - solute carrier family 22 (organic anion transporter), member 13 |