No products
Prices are tax excluded
PTXBC029405
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC029405 |
Product type: | DNA & cDNA |
Ncbi symbol: | H3F3A |
Origin species: | Human |
Product name: | H3F3A-H3 histone, family 3A Gene |
Size: | 2ug |
Accessions: | BC029405 |
Gene id: | 3020 |
Gene description: | H3 histone, family 3A |
Synonyms: | H3.3A; H3F3; histone H3.3; H3 histone, family 3A; H3 histone family member 3A |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggctcgtacaaagcagactgcccgcaaatcgaccggtggtaaagcacccaggaagcaactggctacaaaagccgctcgcaagagtgcgccctctactggaggggtgaagaaacctcatcgttacaggcctggtactgtggcgctccgtgaaattagacgttatcagaagtccactgaacttctgattcgcaaacttcccttccagcgtctggtgcgagaaattgctcaggactttaaaacagatctgcgcttccagagcgcagctatcggtgctttgcaggaggcaagtgaggcctatctggttggcctttttgaagacaccaacctgtgtgctatccatgccaaacgtgtaacaattatgccaaaagacatccagctagcacgccgcatacgtggagaacgtgcttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - PHD finger protein 13 - transducer of ERBB2, 2 - hect domain and RLD 3 - USP6 N-terminal like |