Cart 2 Product Products 512,00 € (empty)
No products
To be determined Shipping
512,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 512,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 512,00 €
Data sheet of PHF13-PHD finger protein 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PHF13-PHD finger protein 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038516 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PHF13 |
| Origin species: | Human |
| Product name: | PHF13-PHD finger protein 13 Gene |
| Size: | 2ug |
| Accessions: | BC038516 |
| Gene id: | 148479 |
| Gene description: | PHD finger protein 13 |
| Synonyms: | PHF5; PHD finger protein 13; PHD zinc finger protein PHF5; survival time-associated PHD finger protein in ovarian cancer 1; survival time-associated PHD protein in ovarian cancer |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactctgactcttgcgccgccgccttccacccggaggaatactcccccagttgcgagaggcgcaggaccgtggaagacttcaacaaattctgcacctttgtcttggcctatgctggctacatcccttatccgaaggaggaactccctttaaggagcagccccagccctgctaacagcactgctggtaccattgacagcgacggctgggacgcgggtttctcagacatcgcgtcctcagtgcccttgccagtctctgaccgctgctttagccacctgcagcctactctcttgcagcgagccaagcccagtaacttcctgctggacagaaagaaaacggacaagctgaagaagaagaagaagaggaagcgcagggacagtgatgcgcctgggaaagaggggtacagggggggcttgctgaagctggaagccgctgacccctacgtggagacccccacgagtcccaccttgcaggatatcccccaggctcccagcgacccctgctcgggctgggactccgatactccctcgagtggatcttgtgccactgtgtcacctgatcaggtcaaagaaataaaaactgaaggcaaacggactatcgtccggcagggaaagcaggtggtgttccgagatgaggacagcactggcaatgatgaggacatcatggtggactcagatgacgattcctgggacctcgtgacctgcttctgcatgaagccatttgccggccgccccatgatcgagtgtaatgagtgccacacctggattcacctgtcctgtgcgaaaatccggaaatccaatgttccagaagtgtttgtctgccaaaagtgccgggactccaagtttgacatccgccgttccaaccgctcgcggacgggctcccggaagctgttcctggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transducer of ERBB2, 2 - hect domain and RLD 3 - USP6 N-terminal like - hect domain and RLD 4 |