Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EID1-EP300 interacting inhibitor of differentiation 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EID1-EP300 interacting inhibitor of differentiation 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007944 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EID1 |
| Origin species: | Human |
| Product name: | EID1-EP300 interacting inhibitor of differentiation 1 Gene |
| Size: | 2ug |
| Accessions: | BC007944 |
| Gene id: | 23741 |
| Gene description: | EP300 interacting inhibitor of differentiation 1 |
| Synonyms: | C15orf3; CRI1; EID-1; IRO45620; PNAS-22; PTD014; RBP21; EP300-interacting inhibitor of differentiation 1; 21 kDa pRb-associated protein; CREBBP/EP300 inhibitor 1; CREBBP/EP300 inhibitory protein 1; E1A-like inhibitor of differentiation 1; NB4 apoptosis related protein; Rb- and p300-binding protein EID-1; retinoblastoma protein-associated protein; EP300 interacting inhibitor of differentiation 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggaaatggctgagttgtccgagctgtatgaagagagcagtgacctgcagatggatgtgatgcctggcgagggtgaccttccgcagatggaggtaggcagcgggagccgggagctatccctgcgtccctcccgcagcggggcccaacagctcgaggaggaaggcccaatggaggaggaggaggcccagccaatggcggcgccagaggggaaacggagccttgctaacgggcccaacgctggggagcagccaggccaggtggcgggcgcagacttcgagagcgaggacgagggcgaggaatttgatgactgggaggacgactacgactatcccgaagaggagcagctcagtggtgccggctacagagtatcagccgctcttgaagaagccgacaagatgtttctgagaacaagagaaccagccctggatggcgggtttcagatgcattatgagaagaccccgtttgatcagttagcttttatcgaagagcttttttcactgatggttgtcaatcgtctgaccgaagaactcggctgtgatgagattattgatagagagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear receptor subfamily 4, group A, member 1 - amiloride-sensitive cation channel 4, pituitary - transcription elongation factor A (SII)-like 3 - leucine rich repeat and Ig domain containing 1 |