Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TCEAL3-transcription elongation factor A (SII)-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TCEAL3-transcription elongation factor A (SII)-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007622 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TCEAL3 |
| Origin species: | Human |
| Product name: | TCEAL3-transcription elongation factor A (SII)-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC007622 |
| Gene id: | 85012 |
| Gene description: | transcription elongation factor A (SII)-like 3 |
| Synonyms: | WEX8; transcription elongation factor A protein-like 3; TCEA-like protein 3; transcription elongation factor A (SII)-like 3; transcription elongation factor S-II protein-like 3; transcription elongation factor A like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaaaaccctacaataaaaatgaaggaaacctggaaaacgagggaaagccagaagatgaagtagagcctgatgatgaaggaaagtcagacgaggaagaaaagccagacgtggaggggaagacagaatgcgagggaaagagagaggatgagggagagccaggtgatgagggacaactggaagatgagggaagccaggaaaagcagggcaggtccgaaggtgagggcaagccacaaggcgagggcaagccagcctcccaggcaaagccagagagccagccgcgggccgccgaaaagcgcccggctgaagattatgtgccccggaaagcaaaaagaaaaacggacagggggacggacgattcccccaaggactctcaggaggacttacaggaaaggcatctgagcagtgaggagatgatgagagaatgtggagatgtgtcaagggctcaagaggagctaaggaaaaaacagaaaatgggtggttttcattggatgcaaagagatgtacaggatccattcgccccaaggggacaacggggtgtcaggggagtgaggggtggaggtaggggccagaggggcttacacgatatcccatacctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat and Ig domain containing 1 - enoyl Coenzyme A hydratase domain containing 2 - nuclear receptor subfamily 2, group C, member 1 - family with sequence similarity 131, member B |