HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene View larger

HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene

PTXBC001236

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001236
Product type: DNA & cDNA
Ncbi symbol: HSPBP1
Origin species: Human
Product name: HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene
Size: 2ug
Accessions: BC001236
Gene id: 23640
Gene description: HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms: FES1; hsp70-binding protein 1; HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1; heat shock protein-binding protein 1; hsp70 interacting protein; HSPA (Hsp70) binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagacgaaggctcaagggggagccgcctgcccctggcgctgcccccggcctcccagggttgctcttcagggggcggcggcggcggcggcggcggctcctcggctgggggctcgggcaattcccggcccccacgcaacctccaaggcttgctgcagatggccatcaccgcgggctctgaagagccagaccctcctccagaaccgatgagtgaggagaggcgtcagtggctgcaggaggccatgtcggctgccttccgaggccagcgggaggaggtggagcagatgaagagctgcctccgagtgctgtcacagcccatgccccccactgctggggaggccgagcaggcggccgaccagcaagagcgagagggggccctggagctgctggccgacctgtgtgagaacatggacaatgccgcagacttctgccagctgtctggcatgcacctgctggtgggccggtacctggaggcgggggctgcgggactgcggtggcgggcggcacagctcatcggcacgtgcagtcagaacgtggcagccatccaggagcaggtgctgggcctgggtgccctgcgtaagctgctgcggctgctggaccgcgacgcctgcgacacggtgcgcgtcaaggccctcttcgccatctcctgtctggtccgagagcaggaggctgggctgctgcagttcctccgcctggacggcttctctgtgttgatgagggccatgcagcagcaggtgcagaagctcaaggtcaaatcagcattcctgctgcagaacctgctggtgggccaccctgaacacaaagggaccctgtgctccatggggatggtccagcagctggtggccctggtgcggacagagcacagccccttccacgagcacgtgcttggagccctgtgcagcctggtgacagactttccgcagggtgtgcgcgagtgtcgggagccggaactgggcctggaggagctcctccgccaccgctgtcagctgctgcagcagcatgaggagtaccaggaggagctggagttctgtgaaaagctgctacagacctgtttctccagcccagcggacgacagcatggatcggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 5 (sodium/glucose cotransporter), member 10
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6
- BTB and CNC homology 1, basic leucine zipper transcription factor 1
- solute carrier family 5 (sodium/glucose cotransporter), member 11

Buy HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene now

Add to cart