SKP2-S-phase kinase-associated protein 2 (p45) Gene View larger

SKP2-S-phase kinase-associated protein 2 (p45) Gene

PTXBC001441

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SKP2-S-phase kinase-associated protein 2 (p45) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SKP2-S-phase kinase-associated protein 2 (p45) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001441
Product type: DNA & cDNA
Ncbi symbol: SKP2
Origin species: Human
Product name: SKP2-S-phase kinase-associated protein 2 (p45) Gene
Size: 2ug
Accessions: BC001441
Gene id: 6502
Gene description: S-phase kinase-associated protein 2 (p45)
Synonyms: FBL1; FBXL1; FLB1; p45; S-phase kinase-associated protein 2; CDK2/cyclin A-associated protein p45; F-box/LRR-repeat protein 1; S-phase kinase-associated protein 2, E3 ubiquitin protein ligase; p45skp2; S-phase kinase associated protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcacaggaagcacctccaggagattccagacctgagtagcaacgttgccaccagcttcacgtggggatgggattccagcaagacttctgaactgctgtcaggcatgggggtctccgccctggagaaagaggagcccgacagtgagaacatcccccaggaactgctctcaaacctgggccacccggagagccccccacggaaacggctgaagagcaaagggagtgacaaagactttgtgattgtccgcaggcctaagctaaatcgagagaactttccaggtgtttcatgggactcccttccggatgagctgctcttgggaatcttttcctgtctgtgcctccctgagctgctaaaggtctctggtgtttgtaagaggtggtatcgcctagcgtctgatgagtctctatggcagaccttagacctcacaggtaaaaatctgcacccggatgtgactggtcggttgctgtctcaaggggtgattgccttccgctgcccacgatcatttatggaccaaccattggctgaacatttcagcccttttcgtgtacagcacatggacctatcgaactcagttatagaagtgtccaccctccacggcatactgtctcagtgttccaagttgcagaatctaagcctggaaggcctgcggctttcggatcccattgtcaatactctcgcaaaaaactcaaatttagtgcgacttaacctttctgggtgttctggattctctgaatttgccctgcagactttgctaagcagctgttccagactggatgagctgaacctctcctggtgttttgatttcactgaaaagcatgtacaggtggctgttgcgcatgtgtcagagaccatcacccagctgaatcttagcggctacagaaagaatctccagaaatcagatctctctactttagttagaagatgccccaatcttgtccatctagacttaagtgatagtgtcatgctaaagaatgactgctttcaggaatttttccagctcaactacctccaacacctatcactcagtcggtgctatgatataatacctgaaactttactattagtgacaagagctggggttaggatccggttggactctgacatcggatgccctcaaacatacagaacttccaaactcaagtccagccataagctattttgccaacatgtcagagtaatctgtatttttgtatgtgatttctacttttatagacttgttttaaaacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 149
- chromosome 10 open reading frame 119
- chromosome 14 open reading frame 159
- zinc finger, CCHC domain containing 10

Buy SKP2-S-phase kinase-associated protein 2 (p45) Gene now

Add to cart