C14orf149-chromosome 14 open reading frame 149 Gene View larger

C14orf149-chromosome 14 open reading frame 149 Gene

PTXBC012131

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf149-chromosome 14 open reading frame 149 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf149-chromosome 14 open reading frame 149 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012131
Product type: DNA & cDNA
Ncbi symbol: C14orf149
Origin species: Human
Product name: C14orf149-chromosome 14 open reading frame 149 Gene
Size: 2ug
Accessions: BC012131
Gene id: 112849
Gene description: chromosome 14 open reading frame 149
Synonyms: C14orf149; trans-3-hydroxy-L-proline dehydratase; L-3-hydroxyproline dehydratase (trans-); trans-3-hydroxyl-L-proline dehydratase; trans-L-3-hydroxyproline dehydratase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagcgcgctggcggtgccctggctgcccccgcatgatccagggacgccggtgctgtcggtggtggacatgcacacgggcggcgagcccttgcgtatcgtgctggcggggtgtccggaggtgtctgggcccaccctgctggccaagcggcgctacatgcgccagcaccttgaccacgtgcggcgacggctcatgttcgagccccgagggcaccgggacatgtacggggcggtcctagtcccgagcgagctgccggacgcgcatctgggcgtcctgttcctgcacaacgagggctacagctccatgtgcggccacgcagtgctggcgctgggccgcttcgctttggacttcgggcttgtgccggcgccccctgcgggcacccgcgaggcccgcgtcaatatccactgcccctgcgggctggtgaccgccttcgtggcatgcgaggacggccgcagccacggaccggtgcgcttccacagcgtcccggccttcgtgctggccacagatctcatggtggatgttcctggacatggaaaggtgatggtggacattgcatatggcggtgcattttatgcatttgttactgctgaaaagttaggactagacatttgttctgcaaagaccagggaccttgtggatgcagcgagtgcagtgacagaggcagtgaaagctcagtttaaaattaatcatcctgatagtgaagaccttgcctttttatatggaactatattaacagatggaaaagatgcttataccaaggaaccaaccaccaacatttgtgtttttgcagatgaacaggttgacagaagtcccactggctcaggagtgacagcccgaattgccttacagtatcacaaagggcttctggaactgaaccagatgagagccttcaaaagcagtgcaactggctcagtattcacagggaaagctgtgagggaagcgaaatgtggtgattttaaagctgttatagtggaagtatcaggacaagcccattacacgggtacagcaagctttataatagaagatgacgacccattgagggatggatttcttctcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 119
- chromosome 14 open reading frame 159
- zinc finger, CCHC domain containing 10
- seven in absentia homolog 1 (Drosophila)

Buy C14orf149-chromosome 14 open reading frame 149 Gene now

Add to cart