RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene View larger

RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014787
Product type: DNA & cDNA
Ncbi symbol: RRP1
Origin species: Human
Product name: RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC014787
Gene id: 8568
Gene description: ribosomal RNA processing 1 homolog (S. cerevisiae)
Synonyms: RRP1-like protein; D21S2056E; NNP-1; NOP52; RRP1A; ribosomal RNA processing protein 1 homolog A; Nnp1 homolog, nucleolar protein; novel nuclear protein 1; nucleolar protein Nop52; protein NNP-1; ribosomal RNA processing 1 homolog; ribosomal RNA processing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcgcgagtggacgggcattgacaggctgcgcctggataaattctacatgctcatgcggatggtcctgaacgagtccttgaaggttctgaagatgcaaggctgggaagaaagacagatcgaggagctgctagagctgctgatgactgagatcctgcaccccagcagccaggcccccaacggtgtgaagagccacttcatcgagatcttcctggaggagctgaccaaagtgggcgccgaggagcttacggcagaccagaacctgaagttcatcgaccccttctgcagaatcgctgcccggaccaaggattccttggttttgaacaacatcactcgaggcatctttgagacgattgtggagcaggccccgcttgccattgaagacctcctgaatgaactggacacacaggatgaggaggtggcgtcggacagtgatgagtcctctgagggtggtgagcgtggagacgcgctgtcccagaagaggtctgagaagccgcccgcaggctccatctgcagggctgaacctgaggctggtgaggagcaggcaggtgacgacagggacagtggcggccccgttctccagtttgactacgaggcagttgctaacagactgtttgaaatggccagccgccagagcaccccttctcagaacagaaagcgtctctacaaagtgatccggaagctgcaggacctggcaggaggcattttccctgaagatgagatcccagagaaggcctgcaggcgcctgcttgaagggaggcggcagaagaagacgaagaagcagaagcgtctgctcaggttgcagcaggagagagggaaaggtgagaaggagcccccgagcccgggcatggagaggaagaggagcaggaggaggggtgtaggggccgaccccgaggcgcgggcagaggctggtgagcagccaggcacagctgagcgggccctgctccgagatcagcccaggggccgtggccagagaggggctcgccagagaaggaggacacctcggcccctgaccagtgcccgagcaaaggcggccaatgtccaggagccggagaagaagaagaaacgcagggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cholinergic receptor, nicotinic, beta 1 (muscle)
- 3'-phosphoadenosine 5'-phosphosulfate synthase 1
- D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)
- v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1

Buy RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene now

Add to cart