Login to display prices
Login to display prices
RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene View larger

RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene

PTXBC014787

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC014787
Ncbi symbol: RRP1
Product name: RRP1-ribosomal RNA processing 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC014787
Gene id: 8568
Gene description: ribosomal RNA processing 1 homolog (S. cerevisiae)
Synonyms: RRP1-like protein; D21S2056E; NNP-1; NOP52; RRP1A; ribosomal RNA processing protein 1 homolog A; Nnp1 homolog, nucleolar protein; novel nuclear protein 1; nucleolar protein Nop52; protein NNP-1; ribosomal RNA processing 1 homolog; ribosomal RNA processing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcgcgagtggacgggcattgacaggctgcgcctggataaattctacatgctcatgcggatggtcctgaacgagtccttgaaggttctgaagatgcaaggctgggaagaaagacagatcgaggagctgctagagctgctgatgactgagatcctgcaccccagcagccaggcccccaacggtgtgaagagccacttcatcgagatcttcctggaggagctgaccaaagtgggcgccgaggagcttacggcagaccagaacctgaagttcatcgaccccttctgcagaatcgctgcccggaccaaggattccttggttttgaacaacatcactcgaggcatctttgagacgattgtggagcaggccccgcttgccattgaagacctcctgaatgaactggacacacaggatgaggaggtggcgtcggacagtgatgagtcctctgagggtggtgagcgtggagacgcgctgtcccagaagaggtctgagaagccgcccgcaggctccatctgcagggctgaacctgaggctggtgaggagcaggcaggtgacgacagggacagtggcggccccgttctccagtttgactacgaggcagttgctaacagactgtttgaaatggccagccgccagagcaccccttctcagaacagaaagcgtctctacaaagtgatccggaagctgcaggacctggcaggaggcattttccctgaagatgagatcccagagaaggcctgcaggcgcctgcttgaagggaggcggcagaagaagacgaagaagcagaagcgtctgctcaggttgcagcaggagagagggaaaggtgagaaggagcccccgagcccgggcatggagaggaagaggagcaggaggaggggtgtaggggccgaccccgaggcgcgggcagaggctggtgagcagccaggcacagctgagcgggccctgctccgagatcagcccaggggccgtggccagagaggggctcgccagagaaggaggacacctcggcccctgaccagtgcccgagcaaaggcggccaatgtccaggagccggagaagaagaagaaacgcagggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: