Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene
PTXBC030691
New product
Data sheet of SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030691 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPOCK1 |
| Origin species: | Human |
| Product name: | SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene |
| Size: | 2ug |
| Accessions: | BC030691 |
| Gene id: | 6695 |
| Gene description: | sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 |
| Synonyms: | SPOCK; TESTICAN; TIC1; testican-1; sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1; SPARC/osteonectin, cwcv and kazal like domains proteoglycan 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggcgatcgcggtgttggcggcggccgccgcggcgtggtgcttcctccaagtcgagagccggcacctggacgcgctcgccggaggcgcgggccccaaccacggcaatttcctagacaatgaccagtggctgagcaccgtctcccagtacgaccgggacaagtactggaaccgctttcgagacgatgattatttcagaaactggaatcccaacaagccctttgacaaagccctggacccatccaaggacccctgcctgaaggtaaaatgcagccctcacaaagtgtgtgtgacccaggactaccagaccgccctgtgtgtcagccgcaagcacctgctccccaggcaaaagaaggggaacgtggcccagaaacactgggttggaccttcgaatttggtcaagtgcaagccctgtcccgtggcacagtcagccatggtctgcggctcagatggccactcctacacatccaagtgcaaattggagttccatgcttgttctactggcaaaagcctcgccaccctctgtgatgggccctgtccctgtctcccagagcctgagccaccaaagcacaaggcagaaaggagtgcctgcacagacaaggagttgcggaaccttgcctcccggctgaaggattggtttggagctctccacgaggatgcgaacagagtcatcaagcccaccagctccaacacagcccaaggcaggtttgacactagcatcctgcccatctgcaaggactccctgggctggatgttcaacaagttggacatgaactatgacctcctgcttgacccttcagagatcaatgccatctacctggataagtacgagccctgtatcaagcctcttttcaactcgtgtgactccttcaaggatggcaagctttctaacaatgagtggtgctactgcttccagaagcctggaggtctcccttgccagaatgaaatgaacagaattcagaagctgagtaaggggaaaagcctgttgggggccttcatacctcggtgtaatgaggagggctattacaaagccacacagtgccacggcagcacggggcagtgctggtgtgtggacaaatatgggaatgagttggctggctccaggaaacagggtgctgtgagctgtgaagaggagcaggaaacctcaggggattttggcagtggtgggtccgtggtcctgctggatgacctagaatatgaacgggagctgggaccaaaggacaaagaggggaagctgagggtgcacacccgagccgtgacagaggatgatgaggatgaggatgatgacaaagaggatgaggtcgggtacatatggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, shaker-related subfamily, beta member 1 - solute carrier family 6 (neurotransmitter transporter, GABA), member 13 - solute carrier family 6 (neurotransmitter transporter, GABA), member 13 - nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene |