SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene View larger

SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene

PTXBC030691

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030691
Product type: DNA & cDNA
Ncbi symbol: SPOCK1
Origin species: Human
Product name: SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene
Size: 2ug
Accessions: BC030691
Gene id: 6695
Gene description: sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Synonyms: SPOCK; TESTICAN; TIC1; testican-1; sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1; SPARC/osteonectin, cwcv and kazal like domains proteoglycan 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggcgatcgcggtgttggcggcggccgccgcggcgtggtgcttcctccaagtcgagagccggcacctggacgcgctcgccggaggcgcgggccccaaccacggcaatttcctagacaatgaccagtggctgagcaccgtctcccagtacgaccgggacaagtactggaaccgctttcgagacgatgattatttcagaaactggaatcccaacaagccctttgacaaagccctggacccatccaaggacccctgcctgaaggtaaaatgcagccctcacaaagtgtgtgtgacccaggactaccagaccgccctgtgtgtcagccgcaagcacctgctccccaggcaaaagaaggggaacgtggcccagaaacactgggttggaccttcgaatttggtcaagtgcaagccctgtcccgtggcacagtcagccatggtctgcggctcagatggccactcctacacatccaagtgcaaattggagttccatgcttgttctactggcaaaagcctcgccaccctctgtgatgggccctgtccctgtctcccagagcctgagccaccaaagcacaaggcagaaaggagtgcctgcacagacaaggagttgcggaaccttgcctcccggctgaaggattggtttggagctctccacgaggatgcgaacagagtcatcaagcccaccagctccaacacagcccaaggcaggtttgacactagcatcctgcccatctgcaaggactccctgggctggatgttcaacaagttggacatgaactatgacctcctgcttgacccttcagagatcaatgccatctacctggataagtacgagccctgtatcaagcctcttttcaactcgtgtgactccttcaaggatggcaagctttctaacaatgagtggtgctactgcttccagaagcctggaggtctcccttgccagaatgaaatgaacagaattcagaagctgagtaaggggaaaagcctgttgggggccttcatacctcggtgtaatgaggagggctattacaaagccacacagtgccacggcagcacggggcagtgctggtgtgtggacaaatatgggaatgagttggctggctccaggaaacagggtgctgtgagctgtgaagaggagcaggaaacctcaggggattttggcagtggtgggtccgtggtcctgctggatgacctagaatatgaacgggagctgggaccaaaggacaaagaggggaagctgagggtgcacacccgagccgtgacagaggatgatgaggatgaggatgatgacaaagaggatgaggtcgggtacatatggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium voltage-gated channel, shaker-related subfamily, beta member 1
- solute carrier family 6 (neurotransmitter transporter, GABA), member 13
- solute carrier family 6 (neurotransmitter transporter, GABA), member 13
- nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene

Buy SPOCK1-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 Gene now

Add to cart