Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene
PTXBC007692
New product
Data sheet of SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPG7 |
| Origin species: | Human |
| Product name: | SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene |
| Size: | 2ug |
| Accessions: | BC007692 |
| Gene id: | 6687 |
| Gene description: | spastic paraplegia 7 (pure and complicated autosomal recessive) |
| Synonyms: | SPG7, paraplegin matrix AAA peptidase subunit; CAR; CMAR; PGN; SPG5C; paraplegin; cell matrix adhesion regulator; spastic paraplegia 7 (pure and complicated autosomal recessive); spastic paraplegia 7 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgtgctgctgctgctgctccgtgccctccgccggggtccaggcccgggtcctcggccgctgtggggcccaggcccggcctggagtccagggttccccgccaggcccgggagggggcggccgtacatggccagcaggcctccgggggacctcgccgaggctgtaggccgagctctgcagagcttacaattgagactgctaacccctacctttgaagggatcaacggattgttgttgaaacaacatttagttcagaatccagtcagactctggcaacttttaggtggtactttctattttaacacctcaaggttgaagcagaagaataaggagaaggataagtcgaaggggaaggcgcctgaagaggacgaagaggagaggagacgccgtgagcgggacgaccagatgtaccgagagcggctgcgcaccttgctggtcatcgcggttgtcatgagcctcctgaatgctctcagcaccagcggaggcagcatttcctggaacgactttgtccacgagatgctggccaagggcgaggtgcagcgcgtccaggtggtgcctgagagcgacgtggtggaagtctacctgcaccctggagccgtggtgtttgggcggcctcggctagccttgatgtaccgaatgcaggttgcaaatattgacaagtttgaagagaagcttcgagcagctgaagatgagctgaatatcgaggccaaggacaggatcccagtttcctacaagcgaacaggattctttggaaatgccctgtactctgtggggatgacggcagtgggcctggccatcctgtggtatgttttccgtctggccgggatgactggaagggaaggtggattcagtgcttttaatcagcttaaaatggctcgtttcaccattgtggatgggaagatggggaaaggagtcagcttcaaagacgtggcaggaatgcacgaagccaaactggaagtccgcgagtttgtggattatctgaagagcccagaacgcttcctccagcttggcgccaaggtcccaaagggcgcactgctgctcggcccccccggctgtgggaagacgctgctggccaaggcggtggccacggaggctcaggtgcccttcctggcgatggccggcccagagttcgtggaggtcattggaggcctcggcgctgcccgtgtgcggagcctctttaaggaagcccgagcccgggccccctgcatcgtctacatcgatgagatcgacgcggtgggcaagaagcgctccaccaccatgtccggcttctccaacacgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) - solute carrier family 9 (sodium/hydrogen exchanger), member 6 - similar to Six transmembrane epithelial antigen of prostate - potassium inwardly-rectifying channel, subfamily J, member 12 |