SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene View larger

SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007692
Product type: DNA & cDNA
Ncbi symbol: SPG7
Origin species: Human
Product name: SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene
Size: 2ug
Accessions: BC007692
Gene id: 6687
Gene description: spastic paraplegia 7 (pure and complicated autosomal recessive)
Synonyms: SPG7, paraplegin matrix AAA peptidase subunit; CAR; CMAR; PGN; SPG5C; paraplegin; cell matrix adhesion regulator; spastic paraplegia 7 (pure and complicated autosomal recessive); spastic paraplegia 7 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgtgctgctgctgctgctccgtgccctccgccggggtccaggcccgggtcctcggccgctgtggggcccaggcccggcctggagtccagggttccccgccaggcccgggagggggcggccgtacatggccagcaggcctccgggggacctcgccgaggctgtaggccgagctctgcagagcttacaattgagactgctaacccctacctttgaagggatcaacggattgttgttgaaacaacatttagttcagaatccagtcagactctggcaacttttaggtggtactttctattttaacacctcaaggttgaagcagaagaataaggagaaggataagtcgaaggggaaggcgcctgaagaggacgaagaggagaggagacgccgtgagcgggacgaccagatgtaccgagagcggctgcgcaccttgctggtcatcgcggttgtcatgagcctcctgaatgctctcagcaccagcggaggcagcatttcctggaacgactttgtccacgagatgctggccaagggcgaggtgcagcgcgtccaggtggtgcctgagagcgacgtggtggaagtctacctgcaccctggagccgtggtgtttgggcggcctcggctagccttgatgtaccgaatgcaggttgcaaatattgacaagtttgaagagaagcttcgagcagctgaagatgagctgaatatcgaggccaaggacaggatcccagtttcctacaagcgaacaggattctttggaaatgccctgtactctgtggggatgacggcagtgggcctggccatcctgtggtatgttttccgtctggccgggatgactggaagggaaggtggattcagtgcttttaatcagcttaaaatggctcgtttcaccattgtggatgggaagatggggaaaggagtcagcttcaaagacgtggcaggaatgcacgaagccaaactggaagtccgcgagtttgtggattatctgaagagcccagaacgcttcctccagcttggcgccaaggtcccaaagggcgcactgctgctcggcccccccggctgtgggaagacgctgctggccaaggcggtggccacggaggctcaggtgcccttcctggcgatggccggcccagagttcgtggaggtcattggaggcctcggcgctgcccgtgtgcggagcctctttaaggaagcccgagcccgggccccctgcatcgtctacatcgatgagatcgacgcggtgggcaagaagcgctccaccaccatgtccggcttctccaacacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)
- solute carrier family 9 (sodium/hydrogen exchanger), member 6
- similar to Six transmembrane epithelial antigen of prostate
- potassium inwardly-rectifying channel, subfamily J, member 12

Buy SPG7-spastic paraplegia 7 (pure and complicated autosomal recessive) Gene now

Add to cart