PTGES2-prostaglandin E synthase 2 Gene View larger

PTGES2-prostaglandin E synthase 2 Gene

PTXBC011613

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTGES2-prostaglandin E synthase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTGES2-prostaglandin E synthase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011613
Product type: DNA & cDNA
Ncbi symbol: PTGES2
Origin species: Human
Product name: PTGES2-prostaglandin E synthase 2 Gene
Size: 2ug
Accessions: BC011613
Gene id: 80142
Gene description: prostaglandin E synthase 2
Synonyms: C9orf15; GBF-1; GBF1; PGES2; mPGES-2; prostaglandin E synthase 2; GATE-binding factor 1; gamma-interferon-activated transcriptional element-binding factor 1; mPGE synthase-2; membrane-associated prostaglandin E synthase 2; microsomal prostaglandin E synthase-2; prostaglandin-H(2) E-isomerase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacccggctgcgcgggtggtgcgggcgctgtggcctggtgggtgcgccttggcctggaggctgggaggccgcccccagccgctgctacccacgcagagccgggctggcttcgcgggggcggcgggcggcccgagccccgtggctgcagctcgtaaggggagcccgcggctgctgggagctgcggcgctggccctggggggagccctggggctgtaccacacggcgcggtggcacctgcgcgcccaggacctccacgcagagcgctcagccgcgcagctctccctgtccagccgcctgcagctgaccctgtaccagtacaagacgtgtcccttctgcagcaaggtccgagccttcctcgacttccatgccctgccctaccaggtggtggaggtgaaccctgtgcgcagggctgagatcaagttctcctcctacagaaaggtgcccatcctggtggcccaggaaggagaaagctcgcaacaactaaatgactcctctgtcatcatcagcgccctcaagacctacctggtgtcggggcagcccctggaagagatcatcacctactacccagccatgaaggctgtgaacgagcagggcaaggaggtgaccgagttcggcaataagtactggctcatgctcaacgagaaggaggcccagcaagtgtatggtgggaaggaggccaggacggaggagatgaagtggcggcagtgggcggacgactggctggtgcacctgatctcccccaatgtgtaccgcacgcccaccgaggctctggcgtcctttgactacattgtccgcgagggcaagttcggagccgtggagggtgccgtggccaagtacatgggtgcagcggccatgtacctcatcagcaagcgactcaagagcaggcaccgcctccaggacaacgtgcgcgaggacctctatgaggctgctgacaagtgggtggctgctgtgggcaaggaccggcccttcatggggggccagaagccgaatctcgctgatttggcggtgtatggcgtgctgcgtgtgatggaggggctggatgcattcgatgacctgatgcagcacacgcacatccagccctggtacctgcgggtggagagggccatcaccgaggcctccccagcgcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH3 and cysteine rich domain
- SCY1-like 1 (S. cerevisiae)
- BCL2-associated athanogene 3
- collagen, type IX, alpha 3

Buy PTGES2-prostaglandin E synthase 2 Gene now

Add to cart