STAC-SH3 and cysteine rich domain Gene View larger

STAC-SH3 and cysteine rich domain Gene

PTXBC020221

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STAC-SH3 and cysteine rich domain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STAC-SH3 and cysteine rich domain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020221
Product type: DNA & cDNA
Ncbi symbol: STAC
Origin species: Human
Product name: STAC-SH3 and cysteine rich domain Gene
Size: 2ug
Accessions: BC020221
Gene id: 6769
Gene description: SH3 and cysteine rich domain
Synonyms: STAC1; SH3 and cysteine-rich domain-containing protein; SRC homology 3 and cysteine-rich domain-containing protein; SH3 and cysteine rich domain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatccctccgagcagcccccgcgaggacggcgtggacgggctgcccaaggaggcggtgggcgccgagcaaccgccctctcctgcatccaccagcagccaggaatccaagctccagaaactaaaacgatcactttctttcaagaccaagagtttacggagcaaaagtgctgacaacttcttccagcgaaccaacagcgaagacatgaaactgcaagcacacatggtggctgagatcagccccagctccagcccactccctgctccaggaagcctgacgtccacacccgccagggctggtctgcatccaggtggcaaggctcatgcctttcatgaatacatcttcaagaagcccactttctgtgatgtctgcaaccacatgatagtgggaacaaatgctaagcatggactgcgctgcaaagcctgtaagatgagcatccaccacaagtgcacagatggcctggcaccccagcggtgcatgggcaagctgccaaaggggtttcggcgttactacagctcccccttgctcattcatgaacagtttggctgcattaaagaagttatgcccattgcctgtggcaataaggtggaccctgtctacgagaccctccgcttcggcacctccctggcccagaggacaaagaagggcagctccggcagtggctctgactcacctcacagaacctctacttcagatcttgtggaggttcctgaggaagccaatgggccaggaggcgggtatgacctaaggaaacgcagcaacagcgtgtttacatatccagaaaatggcactgatgatttcagagatccagcgaagaacataaaccaccagggatctctttccaaagacccattacagatgaacacctatgttgccttgtacaaatttgtaccacaggagaatgaagatttggaaatgaggccaggagacataattactcttttagaggattccaatgaagactggtggaaagggaaaattcaagacagaattggcttctttccagccaactttgttcagagactacaacaaaatgagaagatttttagatgtgttagaaccttcattgggtgtaaggaacaggggcagataacactgaaagagaatcagatctgcgtgagttctgaagaagaacaagatggttttatcagagtcctcagtggaaaaaagaaaggcctcatcccccttgatgtactagaaaacatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SCY1-like 1 (S. cerevisiae)
- BCL2-associated athanogene 3
- collagen, type IX, alpha 3
- dihydropyrimidinase-like 5

Buy STAC-SH3 and cysteine rich domain Gene now

Add to cart