Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FANK1-fibronectin type III and ankyrin repeat domains 1 Gene
PTXBC024189
New product
Data sheet of FANK1-fibronectin type III and ankyrin repeat domains 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FANK1-fibronectin type III and ankyrin repeat domains 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024189 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FANK1 |
| Origin species: | Human |
| Product name: | FANK1-fibronectin type III and ankyrin repeat domains 1 Gene |
| Size: | 2ug |
| Accessions: | BC024189 |
| Gene id: | 92565 |
| Gene description: | fibronectin type III and ankyrin repeat domains 1 |
| Synonyms: | HSD13; fibronectin type 3 and ankyrin repeat domains protein 1; 1700007B22Rik; fibronectin type 3 and ankyrin repeat domains 1; fibronectin type III and ankyrin repeat domains 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagccccagagaatcatgccaccctcaaagcctcatccacctgtcgtgggcaaagtgactcatcacagcattgaattatactgggatctggaaaagaaagccaaacgccaaggacctcaagagcagtggttcaggttctcgattgaagaagaagaccccaaaatgcacacttatggtatcatttatacgggatatgcaacgaagcatgttgttgaaggtctggaaccaaggacgctgtacagatttcgcctgaaggtcaccagcccctctggggagtgtgagtacagcccactcgtctcagtgtctacaaccagagagcccataagtagtgagcacttgcaccgggctgtcagtgtgaatgatgaagatttgctggtccgaatacttcaaggaggccgtgttaaggttgatgttcccaataagtttggctttaccgctctgatggttgctgcccagaaaggatacaccaggcttgtgaaaatcctagtttctaatggcacagacgtgaatctgaagaatggaagtggcaaggacagtctaatgctggcgtgctatgcgggacacctagatgttgtgaaatatctccgaagacatggcgcttcttggcaggctagagacctgggaggctgtacagctctgcactgggctgcagatggaggccactgcagtgtgattgagtggatgataaaggatggctgtgaggtagacgtcgtggacactggttcaggatggaccccactcatgagagtctctgcggtgtcgggaaatcagagggtggcctctcttctaattgatgctggggccaatgtgaatgtgaaggacagaaatggaaagacgccccttatggtggctgtgttaaataatcatgaagagttagttcagttacttcttgacaaaggggcagatgcaagtgtaaaaaatgagttcggcaaaggtgtcctagaaatggccagagtttttgacagacagagtgtagtctccttattagaagaaaggaaaaaaaagcagaggccaaagaagtcttgtgtctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal RNA processing 1 homolog (S. cerevisiae) - cholinergic receptor, nicotinic, beta 1 (muscle) - 3'-phosphoadenosine 5'-phosphosulfate synthase 1 - D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) |