Login to display prices
Login to display prices
FANK1-fibronectin type III and ankyrin repeat domains 1 Gene View larger

FANK1-fibronectin type III and ankyrin repeat domains 1 Gene

PTXBC024189

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FANK1-fibronectin type III and ankyrin repeat domains 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FANK1-fibronectin type III and ankyrin repeat domains 1 Gene

Proteogenix catalog: PTXBC024189
Ncbi symbol: FANK1
Product name: FANK1-fibronectin type III and ankyrin repeat domains 1 Gene
Size: 2ug
Accessions: BC024189
Gene id: 92565
Gene description: fibronectin type III and ankyrin repeat domains 1
Synonyms: HSD13; fibronectin type 3 and ankyrin repeat domains protein 1; 1700007B22Rik; fibronectin type 3 and ankyrin repeat domains 1; fibronectin type III and ankyrin repeat domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccccagagaatcatgccaccctcaaagcctcatccacctgtcgtgggcaaagtgactcatcacagcattgaattatactgggatctggaaaagaaagccaaacgccaaggacctcaagagcagtggttcaggttctcgattgaagaagaagaccccaaaatgcacacttatggtatcatttatacgggatatgcaacgaagcatgttgttgaaggtctggaaccaaggacgctgtacagatttcgcctgaaggtcaccagcccctctggggagtgtgagtacagcccactcgtctcagtgtctacaaccagagagcccataagtagtgagcacttgcaccgggctgtcagtgtgaatgatgaagatttgctggtccgaatacttcaaggaggccgtgttaaggttgatgttcccaataagtttggctttaccgctctgatggttgctgcccagaaaggatacaccaggcttgtgaaaatcctagtttctaatggcacagacgtgaatctgaagaatggaagtggcaaggacagtctaatgctggcgtgctatgcgggacacctagatgttgtgaaatatctccgaagacatggcgcttcttggcaggctagagacctgggaggctgtacagctctgcactgggctgcagatggaggccactgcagtgtgattgagtggatgataaaggatggctgtgaggtagacgtcgtggacactggttcaggatggaccccactcatgagagtctctgcggtgtcgggaaatcagagggtggcctctcttctaattgatgctggggccaatgtgaatgtgaaggacagaaatggaaagacgccccttatggtggctgtgttaaataatcatgaagagttagttcagttacttcttgacaaaggggcagatgcaagtgtaaaaaatgagttcggcaaaggtgtcctagaaatggccagagtttttgacagacagagtgtagtctccttattagaagaaaggaaaaaaaagcagaggccaaagaagtcttgtgtctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: