FANK1-fibronectin type III and ankyrin repeat domains 1 Gene View larger

FANK1-fibronectin type III and ankyrin repeat domains 1 Gene

PTXBC024189

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FANK1-fibronectin type III and ankyrin repeat domains 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FANK1-fibronectin type III and ankyrin repeat domains 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024189
Product type: DNA & cDNA
Ncbi symbol: FANK1
Origin species: Human
Product name: FANK1-fibronectin type III and ankyrin repeat domains 1 Gene
Size: 2ug
Accessions: BC024189
Gene id: 92565
Gene description: fibronectin type III and ankyrin repeat domains 1
Synonyms: HSD13; fibronectin type 3 and ankyrin repeat domains protein 1; 1700007B22Rik; fibronectin type 3 and ankyrin repeat domains 1; fibronectin type III and ankyrin repeat domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccccagagaatcatgccaccctcaaagcctcatccacctgtcgtgggcaaagtgactcatcacagcattgaattatactgggatctggaaaagaaagccaaacgccaaggacctcaagagcagtggttcaggttctcgattgaagaagaagaccccaaaatgcacacttatggtatcatttatacgggatatgcaacgaagcatgttgttgaaggtctggaaccaaggacgctgtacagatttcgcctgaaggtcaccagcccctctggggagtgtgagtacagcccactcgtctcagtgtctacaaccagagagcccataagtagtgagcacttgcaccgggctgtcagtgtgaatgatgaagatttgctggtccgaatacttcaaggaggccgtgttaaggttgatgttcccaataagtttggctttaccgctctgatggttgctgcccagaaaggatacaccaggcttgtgaaaatcctagtttctaatggcacagacgtgaatctgaagaatggaagtggcaaggacagtctaatgctggcgtgctatgcgggacacctagatgttgtgaaatatctccgaagacatggcgcttcttggcaggctagagacctgggaggctgtacagctctgcactgggctgcagatggaggccactgcagtgtgattgagtggatgataaaggatggctgtgaggtagacgtcgtggacactggttcaggatggaccccactcatgagagtctctgcggtgtcgggaaatcagagggtggcctctcttctaattgatgctggggccaatgtgaatgtgaaggacagaaatggaaagacgccccttatggtggctgtgttaaataatcatgaagagttagttcagttacttcttgacaaaggggcagatgcaagtgtaaaaaatgagttcggcaaaggtgtcctagaaatggccagagtttttgacagacagagtgtagtctccttattagaagaaaggaaaaaaaagcagaggccaaagaagtcttgtgtctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal RNA processing 1 homolog (S. cerevisiae)
- cholinergic receptor, nicotinic, beta 1 (muscle)
- 3'-phosphoadenosine 5'-phosphosulfate synthase 1
- D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)

Buy FANK1-fibronectin type III and ankyrin repeat domains 1 Gene now

Add to cart