Login to display prices
Login to display prices
MBIP-MAP3K12 binding inhibitory protein 1 Gene View larger

MBIP-MAP3K12 binding inhibitory protein 1 Gene

PTXBC005197

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MBIP-MAP3K12 binding inhibitory protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MBIP-MAP3K12 binding inhibitory protein 1 Gene

Proteogenix catalog: PTXBC005197
Ncbi symbol: MBIP
Product name: MBIP-MAP3K12 binding inhibitory protein 1 Gene
Size: 2ug
Accessions: BC005197
Gene id: 51562
Gene description: MAP3K12 binding inhibitory protein 1
Synonyms: MAP3K12-binding inhibitory protein 1; MAPK upstream kinase-binding inhibitory protein; MUK-binding inhibitory protein; MAP3K12 binding inhibitory protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctgccacggagcataatcgcccgagcagcggtgacaggaacctggagcgaagatgcagccccaacctctcccgagaggtgctctacgaaatctttcgctccctacacaccctggttggacagcttgacctcagagatgatgtggtgaaaattacaatcgattggaacaagctccagagcctctcggcattccagcctgcattgctctttagtgcacttgaacaacacattttatatttacagccttttttagcaaaacttcagtctccgattaaagaggagaatacaactgctgttgaagagataggaagaacagaaatggggaacaaaaatgaagtaaatgacaaattttccattggcgacctacaagaggaagaaaagcacaaagaaagtgatttaagagatgtgaaaaagacacagatccattttgatccagaagtagttcagataaaggctggaaaagcagaaattgacagacgaatatctgcatttattgaaagaaagcaagctgaaatcaatgaaaacaacgtcagggaattttgcaatgttatcgattgtaatcaagaaaatagttgtgcaagaactgatgcgatttttaccccttaccccggatttaaaagtcacgtaaaagtttctagagttgtgtatacatacggaccacagactagacctgaaggaattccagggtcaggtcataaacctaacagcatgcttcgagactgtggtaatcaggctgtagaagaacgactacaaaatattgaggcccacttgcggttacagacaggtggtccagtgccaagagacatttatcagagaattaaaaaacttgaggataaaatccttgaattggaaggcatctcccctgaatattttcagtctgtaagcttttctggaaaaagaagaaaagttcaaccacctcaacagaactattcactggctgaacttgatgagaaaattagtgccctcaaacaagccctcctcagaaaatcaagagaagcagaatccatggcaacccaccacctcccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: