GTPBP10-GTP-binding protein 10 (putative) Gene View larger

GTPBP10-GTP-binding protein 10 (putative) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GTPBP10-GTP-binding protein 10 (putative) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GTPBP10-GTP-binding protein 10 (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021573
Product type: DNA & cDNA
Ncbi symbol: GTPBP10
Origin species: Human
Product name: GTPBP10-GTP-binding protein 10 (putative) Gene
Size: 2ug
Accessions: BC021573
Gene id: 85865
Gene description: GTP-binding protein 10 (putative)
Synonyms: UG0751c10; GTP-binding protein 10; GTP binding protein 10 (putative); protein obg homolog 2; GTP binding protein 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggttatcctcgtttaggtggagaaggtggaaaaggtggtgatgtctgggttgtagcccagaacagaatgactttaaaacaacttaaagacaggtatcctcggaaacggtttgtggctggagtaggagcaaacagcaaaattagtgcactgaaaggctccaaaggaaaagactgggaaatccctgtgcctgtgggtatttcagtaactgatgaaaatggtaaaattataggagaactcagtaaagaaaatgacagaattttggtagctcaaggaggtcttggtggtaaattacttacaaatttcttaccattgaaaggccagaaacgaataattcaccttgatctaaaacttatagctgatgtaggcctagtaggattcccaaatgctggaaaatcctctttgctaagttgtgtttctcatgcaaaacctgcaattgcagattacgcatttacaacattaaagcctgaacttggaaagataatgtacagtgatttcaaacagatatcagtagctgatcttccgggtttaatagaaggagcacatatgaacaaaggaatgggccacaaattcctcaagcatatagaaagaactagacaactactttttgttgttgatatttctggatttcagctttcttctcacactcaatacaggacagcttttgaaaccataatactgcttacaaaagagttggaattgtacaaagaggaacttcagacaaaacctgcactcttggcagttaataaaatggacttgccagatgcccaagataagttccatgaattgatgagccagctccagaatcctaaagattttctgcatttatttgaaaaaaacatgattccagagaggactgtagagttccaacatatcatccccatatctgcagttactggagaaggaatcgaagaattaaagaattgtataagaaagtcactggatgaacaggccaaccaggaaaatgatgcacttcataagaaacagttgcttaatttgtggatttctgatacaatgtcttctactgagccaccatcaaagcatgctgttactacttccaaaatggatataatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 155
- nuclear transcription factor Y, beta
- G elongation factor, mitochondrial 2
- keratin associated protein 26-1

Buy GTPBP10-GTP-binding protein 10 (putative) Gene now

Add to cart