TMBIM1-transmembrane BAX inhibitor motif containing 1 Gene View larger

TMBIM1-transmembrane BAX inhibitor motif containing 1 Gene

PTXBC007980

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMBIM1-transmembrane BAX inhibitor motif containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMBIM1-transmembrane BAX inhibitor motif containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007980
Product type: DNA & cDNA
Ncbi symbol: TMBIM1
Origin species: Human
Product name: TMBIM1-transmembrane BAX inhibitor motif containing 1 Gene
Size: 2ug
Accessions: BC007980
Gene id: 64114
Gene description: transmembrane BAX inhibitor motif containing 1
Synonyms: LFG3; MST100; MSTP100; PP1201; RECS1; protein lifeguard 3; transmembrane BAX inhibitor motif-containing protein 1; transmembrane BAX inhibitor motif containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccaaccccagcgccccaccaccatatgaagaccgcaaccccctgtacccaggccctctgccccctgggggctatgggcagccatctgtcctgccaggagggtatcctgcctaccctggctacccgcagcctggctacggtcaccctgctggctacccacagcccatgccccccacccacccgatgcccatgaactacggcccaggccatggctatgatggggaggagagagcggtgagtgatagcttcgggcctggagagtgggatgaccggaaagtgcgacacacttttatccgaaaggtttactccatcatctccgtgcagctgctcatcactgtggccatcattgctatcttcacctttgtggaacctgtcagcgcctttgtgaggagaaatgtggctgtctactacgtgtcctatgctgtcttcgttgtcacctacctgatccttgcctgctgccagggacccagacgccgtttcccatggaacatcattctgctgaccctttttacttttgccatgggcttcatgacgggcaccatttccagtatgtaccaaaccaaagccgtcatcattgcaatgatcatcactgcggtggtatccatttcagtcaccatcttctgctttcagaccaaggtggacttcacctcgtgcacaggcctcttctgtgtcctgggaattgtgctcctggtgactgggattgtcactagcattgtgctctacttccaatacgtttactggctccacatgctctatgctgctctgggggccatttgtttcaccctgttcctggcttacgacacacagctggtcctggggaaccggaagcacaccatcagccccgaggactacatcactggcgccctgcagatttacacagacatcatctacatcttcacctttgtgctgcagctgatgggggatcgcaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - EGF-like repeats and discoidin I-like domains 3
- katanin p80 (WD repeat containing) subunit B 1
- EP300 interacting inhibitor of differentiation 1
- nuclear receptor subfamily 4, group A, member 1

Buy TMBIM1-transmembrane BAX inhibitor motif containing 1 Gene now

Add to cart