ZNF215-zinc finger protein 215 Gene View larger

ZNF215-zinc finger protein 215 Gene

PTXBC014538

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF215-zinc finger protein 215 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF215-zinc finger protein 215 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014538
Product type: DNA & cDNA
Ncbi symbol: ZNF215
Origin species: Human
Product name: ZNF215-zinc finger protein 215 Gene
Size: 2ug
Accessions: BC014538
Gene id: 7762
Gene description: zinc finger protein 215
Synonyms: BAZ-2; BAZ2; ZKSCAN11; ZSCAN43; zinc finger protein 215; BAZ 2; BWSCR2-associated zinc finger protein 2; zinc finger protein with KRAB and SCAN domains 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcctctgagcaagttgatggctatctcaaaacctcgaaacctgtctctacgtgaacaaagagaggttctgagagcagatatgtcttggcagcaggaaaccaaccccgtcgtggagacacatgactctgaggcatctcgtcaaaagttcagacatttccagtatttgaaagtgtctgggccccatgaagccctgagccaactctgggagctctgtcttcaatggctgagaccagagattcatacaaagaagcagattatagaactgttggtgctggaacaattcctggcaatcctgcctgaagaagtcaggacttgggtgaatttacaacatccaaacaacagtaaagatatggtgaccctcatagaagatgtgattgaaatgcttgaagatgaagatatgccctgcaaggactctgccctgcagatggggagcatcaaggagaaaatgaaagctggctcacgaacaggcaaaccacaggaaccagtgacattcaaagatgtggttgtggaattcagcaaggaagagtgggggcaactggactctgctgtaaagaacctgtacaggaatgtgatgctggaaaactttaggaacctgaattcattgcgtaaagcacatctactttccaaaccatttgagagccttaagttggagagtaagaaaaaaagatggataatggagaaagaaataccaaggaagactatttttgacatgaagagtatttctggagaagaatcatcccatggagtgattatgacaaggcttaccgaaagtggtcacccttcttcagatgcctggaaagatggagtttccctcttgttgcccaggctggagtataatgatgcagtctcggctcactgcaacctccacctctgggttcaagtgattctcctgcctcagcctcctgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MORN repeat containing 1
- zinc finger protein 643
- PCTAIRE protein kinase 1
- zinc finger protein 213

Buy ZNF215-zinc finger protein 215 Gene now

Add to cart