MORN1-MORN repeat containing 1 Gene View larger

MORN1-MORN repeat containing 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MORN1-MORN repeat containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MORN1-MORN repeat containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021704
Product type: DNA & cDNA
Ncbi symbol: MORN1
Origin species: Human
Product name: MORN1-MORN repeat containing 1 Gene
Size: 2ug
Accessions: BC021704
Gene id: 79906
Gene description: MORN repeat containing 1
Synonyms: MORN repeat-containing protein 1; MORN repeat containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcggcgggcgagggcaccccgagctcccgcgggccgcgtcgggacccgcctaggcggccgccccggaacggttatggtgtctacgtatacccaaattccttctttcgatatgaaggagaatggaaagcagggaggaagcacggtcacgggaagttgttatttaaagatggcagttattacgaaggggcgtttgtggacggagagatcacgggagaaggccgccggcactgggcctggtcaggagacaccttctctggacagtttgttctgggagagcctcaaggctacggcgtcatggagtacaaagccggcggatgttatgaaggggaggtctcccacggcatgcgggaaggacacgggtttctggtggaccgggatggacaagtgtaccagggctccttccatgacaacaagaggcacggccctgggcagatgctctttcagaacggtgacaagtacgacggcgactgggtccgggaccggcgtcagggacacggggtgctgcgctgcgccgacggctccacctacaagggacagtggcacagcgacgtcttcagtggactgggcagcatggcccactgctcaggggtcacctattatgggttgtggatcaatggccacccagcagaacaagctacgaggatcgtgatcttgggtccggaggtgatggaagtggcccaagggtctcccttctcggtgaacgttcagctgctgcaggaccacggggaaattgccaagagcgagagcggccgggtcctgcagatctcagcgggcgtcagatacgtgcagctgtcagcctactctgaggtcaactttttcaaagtggacagagacaaccaagagacactcatccagaccccatttgggttcgaatgcatcccttatcctgtgtccagccccgcagctggggtgccggggcccagagctgccaagggaggggcagaagccgacgtgcccctgcccaggggagacctggagctgtatttgggtgccctccatggccaggaggacacccctggtggcctgcttgggagctcactcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 643
- PCTAIRE protein kinase 1
- zinc finger protein 213
- zinc finger protein 296

Buy MORN1-MORN repeat containing 1 Gene now

Add to cart