Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UCP2-uncoupling protein 2 (mitochondrial, proton carrier) Gene
PTXBC011737
New product
Data sheet of UCP2-uncoupling protein 2 (mitochondrial, proton carrier) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UCP2-uncoupling protein 2 (mitochondrial, proton carrier) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011737 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UCP2 |
| Origin species: | Human |
| Product name: | UCP2-uncoupling protein 2 (mitochondrial, proton carrier) Gene |
| Size: | 2ug |
| Accessions: | BC011737 |
| Gene id: | 7351 |
| Gene description: | uncoupling protein 2 (mitochondrial, proton carrier) |
| Synonyms: | BMIQ4; SLC25A8; UCPH; mitochondrial uncoupling protein 2; solute carrier family 25 member 8; uncoupling protein 2 (mitochondrial, proton carrier) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttgggttcaaggccacagatgtgccccctactgccactgtgaagtttcttggggctggcacagctgcctgcatcgcagatctcatcacctttcctctggatactgctaaagtccggttacagatccaaggagaaagtcaggggccagtgcgcgctacagccagcgcccagtaccgcggtgtgatgggcaccattctgaccatggtgcgtactgagggcccccgaagcctctacaatgggctggttgccggcctgcagcgccaaatgagctttgcctctgtccgcatcggcctgtatgattctgtcaaacagttctacaccaagggctctgagcatgccagcattgggagccgcctcctagcaggcagcaccacaggtgccctggctgtggctgtggcccagcccacggatgtggtaaaggtccgattccaagctcaggcccgggctggaggtggtcggagataccaaagcaccgtcaatgcctacaagaccattgcccgagaggaagggttccggggcctctggaaagggacctctcccaatgttgctcgtaatgccattgtcaactgtgctgagctggtgacctatgacctcatcaaggatgccctcctgaaagccaacctcatgacagatgacctcccttgccacttcacttctgcctttggggcaggcttctgcaccactgtcatcgcctcccctgtagacgtggtcaagacgagatacatgaactctgccctgggccagtacagtagcgctggccactgtgcccttaccatgctccagaaggaggggccccgagccttctacaaagggttcatgccctcctttctccgcttgggttcctggaacgtggtgatgttcgtcacctatgagcagctgaaacgagccctcatggctgcctgcacttcccgagaggctcccttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium channel, voltage-dependent, beta 1 subunit - ring finger and CHY zinc finger domain containing 1 - olfactory receptor, family 2, subfamily H, member 1 - wingless-type MMTV integration site family, member 4 |