Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OR2H1-olfactory receptor, family 2, subfamily H, member 1 Gene
PTXBC048991
New product
Data sheet of OR2H1-olfactory receptor, family 2, subfamily H, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR2H1-olfactory receptor, family 2, subfamily H, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC048991 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR2H1 |
| Origin species: | Human |
| Product name: | OR2H1-olfactory receptor, family 2, subfamily H, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC048991 |
| Gene id: | 26716 |
| Gene description: | olfactory receptor, family 2, subfamily H, member 1 |
| Synonyms: | 6M1-16; HS6M1-16; OLFR42A-9004-14; OLFR42A-9004.14/9026.2; OR2H6; OR2H8; OR6-2; dJ994E9.4; olfactory receptor 2H1; olfactory receptor 2H6; olfactory receptor 2H8; olfactory receptor 6-2; olfactory receptor OR6-32; olfactory receptor, family 2, subfamily H, member 6; olfactory receptor, family 2, subfamily H, member 8; olfactory receptor family 2 subfamily H member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttaaccaaagctcccccatgggcttcctccttctgggcttctctgaacacccagcactggaaaggactctctttgtggttgtcttcacttcctacctcttgaccctggtgggcaacacactcatcatcctgctgtctgtactgtaccccaggctccactctccaatgtactttttcctctctgacctctccttcttggacctctgctttaccacaagttgtgtcccccagatgctggtcaacctctggggcccaaagaagaccatcagcttcctgggatgctctgtccagctcttcatcttcctgtccctggggaccactgagtgcatcctcctgacagtgatggcctttgaccgatacgtggctgtctgccagcccctccactatgccaccatcatccacccccgcctgtgctggcagctggcatctgtggcctgggttatgagtctggttcaatcgatagtccagacaccatccaccctccacttgcccttctgtccccaccagcagatagatgactttttatgtgaggtcccatctctgattcgactctcctgtggagatacctcctacaatgaaatccagttggctgtgtccagtgtcatcttcgtggttgtgcctctcagcctcatccttgcctcttatggagccactgcccaggcagtgctgaggattaactctgccacagcatggagaaaggcctttgggacctgctcctcccatctcactgtggtcaccctcttctacagctcagtcattgctgtctacctccagcccaaaaatccgtatgcccaagggaggggcaagttctttggtctcttctatgcagtgggcactccttcacttaaccctctcgtatacaccctgaggaacaaggagataaagcgagcactcaggaggttactagggaaggaaagagactccagggaaagctggagagctgcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - wingless-type MMTV integration site family, member 4 - mitogen-activated protein kinase kinase kinase 12 - vacuolar protein sorting 41 homolog (S. cerevisiae) - intraflagellar transport 52 homolog (Chlamydomonas) |