Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TOMM34-translocase of outer mitochondrial membrane 34 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TOMM34-translocase of outer mitochondrial membrane 34 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001763 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TOMM34 |
| Origin species: | Human |
| Product name: | TOMM34-translocase of outer mitochondrial membrane 34 Gene |
| Size: | 2ug |
| Accessions: | BC001763 |
| Gene id: | 10953 |
| Gene description: | translocase of outer mitochondrial membrane 34 |
| Synonyms: | HTOM34P; TOM34; URCC3; mitochondrial import receptor subunit TOM34; hTom34; outer mitochondrial membrane translocase (34kD); translocase of outer membrane 34 kDa subunit; translocase of outer mitochondrial membrane 34 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccccaaattcccagactctgtggaggagctccgcgccgccggcaatgagagtttccgcaacggccagtacgccgaggcctccgcgctctacggccgcgcgctgcgggtgctgcaggcgcaaggttcttcagacccagaagaagaaagtgttctctactccaaccgagcagcatgtcacttgaaggatggaaactgcagagactgcatcaaagattgcacttcagcactggccttggttcccttcagcattaagcccctgctgcggcgagcatctgcttatgaggctctggagaagtaccctatggcctatgttgactataagactgtgctgcagattgatgataatgtgacgtcagccgtagaaggcatcaacagaatgaccagagctctcatggactcgcttgggcctgagtggcgcctgaagctgccctcaatccccttggtgcctgtttcagctcagaagaggtggaattccttgccttcggagaaccacaaagagatggctaaaagcaaatccaaagaaaccacagctacaaagaacagagtgccttctgctggggatgtggagaaagccagagttctgaaggaagaaggcaatgagcttgtaaagaagggaaaccataagaaagctattgagaagtacagtgaaagcctcttgtgtagtaacctggaatctgccacgtacagcaacagagcactctgctatttggtcctgaagcagtacacagaagcagtgaaggactgcacagaagccctcaagctggatggaaagaacgtgaaggcattctacagacgggctcaagcccacaaagcactcaaggactataaatccagctttgcagacatcagcaacctcctacagattgagcctaggaatggtcctgcacagaagttgcggcaggaagtgaagcagaacctacactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATG5 autophagy related 5 homolog (S. cerevisiae) - transmembrane BAX inhibitor motif containing 1 - EGF-like repeats and discoidin I-like domains 3 - katanin p80 (WD repeat containing) subunit B 1 |