Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FLJ22167-hypothetical protein FLJ22167 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ22167-hypothetical protein FLJ22167 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010609 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ22167 |
| Origin species: | Human |
| Product name: | FLJ22167-hypothetical protein FLJ22167 Gene |
| Size: | 2ug |
| Accessions: | BC010609 |
| Gene id: | 79583 |
| Gene description: | hypothetical protein FLJ22167 |
| Synonyms: | I-GlcNAc-6-ST; I-GlcNAc6ST; glcNAc6ST-3; gn6st-3; hIGn6ST; carbohydrate sulfotransferase 5; GST4-alpha; N-acetylglucosamine 6-O-sulfotransferase 3; carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5; galactose/N-acetylglucosamine/N-acetylglucosamine 6-O-sulfotransferase 4-alpha; intestinal GlcNAc-6-sulfotransferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctctatgagctcttctctcacccggtcgagcgcagttaccgcgcggggctctgctccaaagccgcgctgttcctgctgctggccgctgcgctcacgtacatcccgccgctgctggtggccttccggagccacgggttttggctgaagcggagcagctacgaggagcagccgaccgtgcgcttccaacaccaggtgctgctcgtggccctgctcggacccgaaagcgacgggttcctcgcctggagcacgttccccgccttcaaccggctgcaaggggatcgcctgcgcgtcccgctcgtttcgactagagaagaagacaggaaccaggatgggaagacggacatgttacattttaagctggagcttcccctgcagtccacggagcacgttctcggtgtgcagctcatcctgactttctcctatcgattacacaggatggcgaccctcgtgatgcagagcatggcgtttctccagtcctcctttcctgtcccgggatcccagttatacgtgaacggagacctgaggctgcagcagaagcagccgctgagctgtggtggcctagatgcccgatacaacatatccgtgatcaacgggaccagcccctttgcctatgactacgacctcacccatattgttgctgcctaccaggagaggaacgttaccaccgtcctgaatgatcccaaccccatctggctggtgggcagggccgcagatgctccatttgtgattaatgctatcatccgataccctgtggaagtcatttcttatcagccaggattctgggagatggtaaagttcgcctgggtgcagtatgtcagcatcctgcttatcttcctctgggtgtttgaaagaatcaagatcttcgtgtttcagaatcaggtggtgaccaccattcctgtgacagtgacgccccggggagacttgtgtaaggagcacttatcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium homeostasis modulator 1 - 24-dehydrocholesterol reductase - SEC16 homolog B (S. cerevisiae) - quiescin Q6 sulfhydryl oxidase 1 |