CALHM1-calcium homeostasis modulator 1 Gene View larger

CALHM1-calcium homeostasis modulator 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALHM1-calcium homeostasis modulator 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CALHM1-calcium homeostasis modulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036193
Product type: DNA & cDNA
Ncbi symbol: CALHM1
Origin species: Human
Product name: CALHM1-calcium homeostasis modulator 1 Gene
Size: 2ug
Accessions: BC036193
Gene id: 255022
Gene description: calcium homeostasis modulator 1
Synonyms: FAM26C; calcium homeostasis modulator protein 1; family with sequence similarity 26, member C; calcium homeostasis modulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggacaagttccggatgatcttccagttcctgcagtccaaccaggagtccttcatgaatggcatctgtggcatcatggccctggccagtgcccagatgtactcggccttcgacttcaactgcccctgcctgccgggctacaatgcggcctacagcgcgggcatcctgctggcgccacccctggtgctctttctgcttggcctggtcatgaacaacaacgtgtccatgctggccgaagagtggaagcggccaccgggccgccgggccaaggaccccgctgtgttgcgctacatgttctgctccatggcccagcgcgccctcatcgcgcctgtcgtctgggtggccgtcacgctactcgacggcaaatgcttcctctgtgccttctgcactgccgtgcccgtgagcgcactgggcaacggcagcctggcacccggccttcctgcccccgagctcgcccgcctgctggcccgggtgccctgccctgagatctacgatggcgactggctgttggcccgagaggtggccgtgcgttacctccgctgcatctcccaggcgctgggctggtccttcgtgctgctgaccactctgctggcattcgtggtgcgctctgtgcggccctgcttcacgcaggccgccttcctcaagagcaagtactggtcccactatatcgacatcgagcgcaagctcttcgacgagacgtgcacggagcacgccaaagcctttgccaaggtctgcatccagcagttcttcgaggccatgaaccatgacctggagctgggtcacaccaacgggacactggccacggcccctgcttccgcagctgcccccacgacccccgatggtgcggaggaggaaagggagaagctgcgtggcatcacggatcaaggcaccatgaacaggctgctcacgagctggcacaaatgcaaaccgcctctgcggctgggccaggaggagccaccgctgatgggcaacggctgggctgggggtgggccccggcctccgcgtaaggaggtggccacctacttcagcaaagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 24-dehydrocholesterol reductase
- SEC16 homolog B (S. cerevisiae)
- quiescin Q6 sulfhydryl oxidase 1
- heat shock 70kDa protein 1-like

Buy CALHM1-calcium homeostasis modulator 1 Gene now

Add to cart