Cart 3 Product Products 482,80 € (empty)
-
1 x CYCS-cytoc...113,40 € -
1 x ALKBH3-alk...113,40 € -
No products
To be determined Shipping
482,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 482,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 482,80 €
View larger 
Data sheet of ALDH3B1-aldehyde dehydrogenase 3 family, member B1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALDH3B1-aldehyde dehydrogenase 3 family, member B1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002553 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALDH3B1 |
| Origin species: | Human |
| Product name: | ALDH3B1-aldehyde dehydrogenase 3 family, member B1 Gene |
| Size: | 2ug |
| Accessions: | BC002553 |
| Gene id: | 221 |
| Gene description: | aldehyde dehydrogenase 3 family, member B1 |
| Synonyms: | ALDH4; aldehyde dehydrogenase family 3 member B1; aldehyde dehydrogenase 3B1; aldehyde dehydrogenase 7; aldehyde dehydrogenase 3 family member B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacccccttggggacacgctgcggcgactgcgggaggccttccacgcggggcgcacacggccagctgagttccgggctgcgcagctccaaggcctgggccgcttcctgcaagaaaacaagcagcttctgcacgacgcactggcccaggacctgcacaagtcagccttcgagtcggaggtgtctgaggttgccatcagccagggcgaggtcaccctggccctcaggaacctccgggcctggatgaaggacgagcgtgtgcccaagaacctggccacgcagctggactccgccttcatccggaaggagccctttggcctggtcctcatcattgcgccctggaactatccgctgaacctgacgctggtgcccctcgtgggagccctcgctgcagggaactgtgtggtgctgaagccatcggagattagcaagaacgtcgagaagatcctggccgaggtgctgccccaatacgtggaccagagctgctttgctgtggtgctgggcgggccccaggagacggggcagctgctagagcacaggttcgactacatcttcttcacagggagccctcgtgtgggcaagattgttatgactgctgccgccaagcacccctcaaagcagcgcctgcctcctccctcctgggtcttccctctccctgcctcagcctcctccctcagccgctcccaaccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 8 - DnaJ (Hsp40) homolog, subfamily A, member 3 - La ribonucleoprotein domain family, member 1 - hydroxysteroid (17-beta) dehydrogenase 14 |