Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJB8-DnaJ (Hsp40) homolog, subfamily B, member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB8-DnaJ (Hsp40) homolog, subfamily B, member 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029521 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJB8 |
| Origin species: | Human |
| Product name: | DNAJB8-DnaJ (Hsp40) homolog, subfamily B, member 8 Gene |
| Size: | 2ug |
| Accessions: | BC029521 |
| Gene id: | 165721 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 8 |
| Synonyms: | CT156; DJ6; dnaJ homolog subfamily B member 8; DnaJ (Hsp40) homolog, subfamily B, member 8; testicular tissue protein Li 56; DnaJ heat shock protein family (Hsp40) member B8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaactactacgaagtgctgggcgtgcaggccagcgcttccccggaggacatcaagaaagcctaccgcaagctggcccttcgttggcaccccgacaagaaccctgacaataaggaggaggcggagaagaagttcaagctggtgtctgaggcctatgaggttctgtctgactccaagaaacgctccctgtatgaccgtgctggctgtgacagctggcgggctggtggcggggccagcacgccctaccacagccccttcgacaccggctacaccttccgtaaccctgaggacatcttccgggagtttttcggtggcctggaccctttctcctttgagttctgggacagcccattcaatagtgaccgtggtggccggggccatggcctgaggggggccttctcggcaggctttggagaatttccggccttcatggaggccttctcatccttcaacatgctgggctgcagcgggggcagccacaccaccttctcatccacctccttcgggggctccagttctggcagctcggggttcaagtcggtgatgtcgtccaccgagatgatcaatggccacaaggtcaccaccaagcgcatcgtggagaacgggcaggagcgcgtggaggtggaggaagacgggcagctcaagtcggtgactgtgaacggcaaggagcagctcaaatggatggacagcaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily A, member 3 - La ribonucleoprotein domain family, member 1 - hydroxysteroid (17-beta) dehydrogenase 14 - branched chain aminotransferase 1, cytosolic |