Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IGLC1-immunoglobulin lambda constant 1 (Mcg marker) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IGLC1-immunoglobulin lambda constant 1 (Mcg marker) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007782 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IGLC1 |
| Origin species: | Human |
| Product name: | IGLC1-immunoglobulin lambda constant 1 (Mcg marker) Gene |
| Size: | 2ug |
| Accessions: | BC007782 |
| Gene id: | 3537 |
| Gene description: | immunoglobulin lambda constant 1 (Mcg marker) |
| Synonyms: | iglc1; lc1-14; immunoglobulin light chain type 1; immunoglobulin light iota variable 1, s5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctggaccgttctcctcctcggcctcctctctcactgcacaggttcagggacctcctatgtgttgactcagccagcctcggtgtcagtggccccaggacagacggccaggattacctgtgggggaagcaaccttggaagcaaaagtgttaactggtatcaactgaggccaggccaggcccctattctggtcgtctatgaaaataaagagcggcccgcagggatccctgagcgactctccgccctcacttctgaggaaacggccaccctcaccatcagcagcgtcgtcgccggggatgaggccgactatttctgtcaggtgtgggacactactagtcaacaatatgtcttcggaactgggacccaggtcaccgtcctaggtcagcccaaggccaaccccactgtcactctgttcccgccctcctctgaggagctccaagccaataaggccacactagtgtgtctgatcagtgacttctacccgggagctgtgacagtggcctggaaggcagatggcagccccgtcaaggcgggagtggagaccaccaaaccctccaaacagagcaacaacaagtacgcggccagcagctacctgagcctgacgcccgagcagtggaagtcccacagaagctacagctgccaggtcacgcatgaagggagcaccgtggagaagacagtggcccctacagaatgttcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calmodulin binding transcription activator 2 - family with sequence similarity 64, member A - family with sequence similarity 76, member A - WAS/WASL interacting protein family, member 1 |