WIPF1-WAS/WASL interacting protein family, member 1 Gene View larger

WIPF1-WAS/WASL interacting protein family, member 1 Gene

PTXBC002914

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WIPF1-WAS/WASL interacting protein family, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WIPF1-WAS/WASL interacting protein family, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002914
Product type: DNA & cDNA
Ncbi symbol: WIPF1
Origin species: Human
Product name: WIPF1-WAS/WASL interacting protein family, member 1 Gene
Size: 2ug
Accessions: BC002914
Gene id: 7456
Gene description: WAS/WASL interacting protein family, member 1
Synonyms: PRPL-2; WAS2; WASPIP; WAS/WASL-interacting protein family member 1; WASP-interacting protein; Wiskott-Aldrich syndrome protein interacting protein; protein PRPL-2; testicular tissue protein Li 226; WAS/WASL interacting protein family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgtccctccccctccagcacccccgccgcccccgacgtttgcactggccaatacagagaagcctaccttgaataagacagagcaggctgggagaaatgctctcctttctgatatcagcaaagggaagaaactaaagaagacggtcaccaatgacagaagtgcaccaatactggacaaacctaaaggagctggtgctggaggcggtggtggtggctttggtggaggcggcggatttggcggaggaggtggtggcggaggcggtggaagttttggagggggcggacctccaggtctgggaggattgttccaggctggaatgccgaagctgagatccacggccaacagggataatcattctggaggaagccgaccaccattgttgccaccgggaggaagatccacatctgcgaaacccttttcacccccaagtggcccagggaggtttcctgtgccttctccaggccacagaagtggtcccccagagcctcagaggaaccgaatgccgcccccaaggcccgacgtgggctcaaagcctgatagcattcctcctccagtacctagtactccaagacccattcaatcaagtctgcacaaccgggggtccccaccagtgcccggaggccccaggcagcccagccccgggcccactcctcccccacctccagtgagggacccgccaggccgatcaggccccctcccaccacctcctccagtaagcagaaacggcagcacatctcgggccctgcctgctacccctcagttgccatccaggagtggagtagacagtcccaggagtggacccaggcctccccttcctcctgataggcccagtgctggggcacctcccccacctccaccatcaacatctattagaaatggcttccaagactctccatgtgaagatgagtgggaaagcagattctacttccatccgatttccgatttgccacctccagagccatatgtacaaacgaccaaaagttatcccagcaaactggcaagaaacgaaagccggagtggatccaaccgaagagaaaggggtgctccaccactccctcccatcccgaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pleckstrin homology domain interacting protein
- dynein, cytoplasmic 1, intermediate chain 2
- family with sequence similarity 65, member B
- family with sequence similarity 26, member D

Buy WIPF1-WAS/WASL interacting protein family, member 1 Gene now

Add to cart