Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RALB-v-ral simian leukemia viral oncogene homolog B (ras related, GTP binding protein) Gene
PTXBC018163
New product
Data sheet of RALB-v-ral simian leukemia viral oncogene homolog B (ras related, GTP binding protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RALB-v-ral simian leukemia viral oncogene homolog B (ras related, GTP binding protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018163 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RALB |
| Origin species: | Human |
| Product name: | RALB-v-ral simian leukemia viral oncogene homolog B (ras related, GTP binding protein) Gene |
| Size: | 2ug |
| Accessions: | BC018163 |
| Gene id: | 5899 |
| Gene description: | v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) |
| Synonyms: | RALB Ras like proto-oncogene B; ras-related protein Ral-B; RAS-like protein B; ras related GTP binding protein B; v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein); RAS like proto-oncogene B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgccaacaagagtaagggccagagctccttggccctccacaaggtgatcatggttggcagcggaggcgttggcaagtcagccctgacgcttcagttcatgtatgacgagtttgtagaagactatgaacctaccaaagctgacagttatagaaagaaagtggttcttgatggggaagaagttcagatagatattctggacaccgctgggcaagaggactacgcagccattcgagataactactttcggagtggggaagggtttcttcttgtgttctcaatcacagaacatgaatcctttacagcaactgccgaattcagggaacagattctccgtgtgaaggctgaagaagataaaattccactgctcgtcgtgggaaacaagtctgacctagaggagcggaggcaggtgcctgtggaggaggccaggagtaaagccgaagagtggggcgtgcagtacgtggagacgtcagcgaagacccgggccaacgtggacaaggtgttctttgacctaatgagagaaatcagaacaaagaagatgtcagaaaacaaagacaagaatggcaagaaaagcagcaagaacaagaaaagttttaaagaaagatgttgcttactatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) - ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) |