Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ROBO3-roundabout, axon guidance receptor, homolog 3 (Drosophila) Gene
PTXBC008623
New product
Data sheet of ROBO3-roundabout, axon guidance receptor, homolog 3 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ROBO3-roundabout, axon guidance receptor, homolog 3 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008623 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ROBO3 |
| Origin species: | Human |
| Product name: | ROBO3-roundabout, axon guidance receptor, homolog 3 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC008623 |
| Gene id: | 64221 |
| Gene description: | roundabout, axon guidance receptor, homolog 3 (Drosophila) |
| Synonyms: | HGPPS; HGPS; RBIG1; RIG1; roundabout homolog 3; retinoblastoma inhibiting gene 1; roundabout, axon guidance receptor, homolog 3; roundabout-like protein 3; roundabout guidance receptor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactcccccacttcaaggaccccgtgctcgattccggaagaaacccaaggctcttccctacaggagggagaacagtcctggggacttgcccccaccacccttgccaccgccagaggaagaggcgagctgggccctagagctgagggcagcaggcagcatgtcctccctggagcgggagcgcagtggggagaggaaagcggtccaggccgtgcccctggcagcccagcgggtgctccacccagatgaagaggcctggctcccatacagcagaccaagcttcctgtcccggggccagggcaccagcacatgttccacggccggcagcaactcttccaggggctccagcagctctaggggctcccggggccctggccggagccggagtcagagccggagccagagccaaaggccaggacagaaacgccgagaggaaccaagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |