Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMD9-proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 Gene
PTXBC002383
New product
Data sheet of PSMD9-proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMD9-proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002383 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMD9 |
| Origin species: | Human |
| Product name: | PSMD9-proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 Gene |
| Size: | 2ug |
| Accessions: | BC002383 |
| Gene id: | 5715 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
| Synonyms: | Rpn4; p27; 26S proteasome non-ATPase regulatory subunit 9; 26S proteasome regulatory subunit p27; homolog of rat Bridge 1; proteasome (prosome, macropain) 26S subunit, non-ATPase, 9; proteasome 26S non-ATPase regulatory subunit 9; proteasome 26S subunit, non-ATPase 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgacgaggaagcgaggcagagcggaggctcctcgcaggccggcgtcgtgactgtcagcgacgtccaggagctgatgcggcgcaaggaggagatagaagcgcagatcaaggccaactatgacgtgctggaaagccaaaaaggcattgggatgaacgagccgctggtggactgtgagggctacccccggtcagacgtggacctgtaccaagtccgcaccgccaggcacaacatcatatgcctgcagaatgatcacaaggcagtgatgaagcaggtggaggaggccctgcaccagctgcacgctcgcgacaaggagaagcaggcccgggacatggctgaggcccacaaagaggccatgagccgcaaactgggtcagagtgagagccagggccctccacgggccttcgccaaagtgaacagcatcagccccggctccccagccagcatcgcgggtctgcaagtggatgatgagattgtggagttcggctctgtgaacacccagaacttccagtcactgcataacattggcagtgtggtgcagcacagtgaggggaagcccctgaatgtgacagtgatccgcaggggggaaaaacaccagcttagacttgttccaacacgctgggcaggaaaaggactgctgggctgcaacattattcctctgcaaagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 - solute carrier family 1 (glutamate transporter), member 7 - peptidylprolyl isomerase domain and WD repeat containing 1 - v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) |