Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF4EBP3-eukaryotic translation initiation factor 4E binding protein 3 Gene
PTXBC010881
New product
Data sheet of EIF4EBP3-eukaryotic translation initiation factor 4E binding protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF4EBP3-eukaryotic translation initiation factor 4E binding protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010881 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF4EBP3 |
| Origin species: | Human |
| Product name: | EIF4EBP3-eukaryotic translation initiation factor 4E binding protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC010881 |
| Gene id: | 8637 |
| Gene description: | eukaryotic translation initiation factor 4E binding protein 3 |
| Synonyms: | 4E-BP3; 4EBP3; eukaryotic translation initiation factor 4E-binding protein 3; eIF4E-binding protein 3; eukaryotic initiation factor 4E-binding protein 3; eukaryotic translation initiation factor 4E binding protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcaacgtccactagctgcccgattcccgggggccgggaccagctgcccgactgctacagcaccacgccggggggcacgctatacgccactacccccggaggcaccaggatcatctacgaccgaaagttcctgctggagtgcaagaactcacccattgcccggacacccccctgctgcctccctcagattcccggggtcacaactcctccaacagcccctctctccaagctggaggagctgaaggagcaggagacagaggaagagatacccgatgacgcacaatttgaaatggacatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 13 (sodium/sulfate symporters), member 4 - leucine rich repeat and fibronectin type III domain containing 5 - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 - DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) |