Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene
PTXBC016278
New product
Data sheet of LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016278 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOH3CR2A |
| Origin species: | Human |
| Product name: | LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene |
| Size: | 2ug |
| Accessions: | BC016278 |
| Gene id: | 29931 |
| Gene description: | loss of heterozygosity, 3, chromosomal region 2, gene A |
| Synonyms: | LOH3CR2A; ERR-10; ERR10; NAG-7; NCRNA00312; long intergenic non-protein coding RNA 312 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccatcattctttaaacacattttacatctggcacaataacgtgctacatacccatcttgtatttttcctgccccatcttttaaatcagccattctcaaggggttccttcttaatctggctgttgttgtgttggaactcctggtaccatcttagaaccttaaggagacaagcgaaccaagccaataagctttccatgatgctgcttagagttaaacagagcccaggtactaagttatgtcatggagacagtgaactaacctctggactgcttgctacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin, light chain 6, alkali, smooth muscle and non-muscle - roundabout, axon guidance receptor, homolog 3 (Drosophila) - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) |