Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C9orf123-chromosome 9 open reading frame 123 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C9orf123-chromosome 9 open reading frame 123 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009510 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C9orf123 |
| Origin species: | Human |
| Product name: | C9orf123-chromosome 9 open reading frame 123 Gene |
| Size: | 2ug |
| Accessions: | BC009510 |
| Gene id: | 90871 |
| Gene description: | chromosome 9 open reading frame 123 |
| Synonyms: | transmembrane protein C9orf123; C9orf123; transmembrane protein 261 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtctcggttgtcccagccttttgagtcctatatcactgcgcctcccggtaccgccgccgcgcccgccaaacctgcgcccccagctacacccggagcgccgacctccccagcagaacaccgcctgttgaagacctgctggagctgtcgcgtgctttctgggttggggctgatgggggcgggcgggtacgtgtactgggtggcacggaagcccatgaagatgggataccccccgagtccatggaccattacgcagatggtcatcggcctcagtgagaatcaaggcattgccacctggggtatcgttgtcatggcagaccccaaagggaaggcctaccgcgttgtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 12 open reading frame 54 - pleckstrin and Sec7 domain containing 3 - defensin, alpha 3, neutrophil-specific - chromosome 14 open reading frame 65 |