Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PSD3-pleckstrin and Sec7 domain containing 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSD3-pleckstrin and Sec7 domain containing 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011238 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSD3 |
| Origin species: | Human |
| Product name: | PSD3-pleckstrin and Sec7 domain containing 3 Gene |
| Size: | 2ug |
| Accessions: | BC011238 |
| Gene id: | 23362 |
| Gene description: | pleckstrin and Sec7 domain containing 3 |
| Synonyms: | EFA6D; HCA67; PH and SEC7 domain-containing protein 3; ADP-ribosylation factor guanine nucleotide factor 6; epididymis tissue protein Li 20mP; exchange factor for ADP-ribosylation factor guanine nucleotide factor 6; hepatocellular carcinoma-associated antigen 67; pleckstrin homology and SEC7 domain-containing protein 3; pleckstrin and Sec7 domain containing 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttggttaatggagagaattttggagtttcacttaatattttcccatcggtcgccataaataagtcttcaggcgctcctagaagagtcccagcccaaggctcgattaaggaccacactgcaggtctgaggctcactgctctgagtcctgaacaccagagccctgcagagagtggtgataacacatcatctctgcaaagaggaacctctcccccggccgccacttcactcaggcttctactgagcagcaaggacagcctgggtttcaaatgccacttcccctgctttagggatccaggtgtcctgatagcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - defensin, alpha 3, neutrophil-specific - chromosome 14 open reading frame 65 - chromosome 6 open reading frame 134 - chromosome 17 open reading frame 62 |