PTXBC009702
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009702 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJC19 |
| Origin species: | Human |
| Product name: | DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene |
| Size: | 2ug |
| Accessions: | BC009702 |
| Gene id: | 131118 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 19 |
| Synonyms: | PAM18; TIM14; TIMM14; mitochondrial import inner membrane translocase subunit TIM14; DnaJ (Hsp40) homolog, subfamily C, member 19; DnaJ-like protein subfamily C member 19; homolog of yeast TIM14; DnaJ heat shock protein family (Hsp40) member C19 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagtacagtggtagcagttggactgaccattgctgctgcaggatttgcaggccgttacgttttgcaagccatgaagcatatggagcctcaagtaaaacaagtttttcaaagcctaccaaaatctgccttcagtggtggctattatagaggtgggtttgaacccaaaatgacaaaacgggaagcagcattaatactaggtgtaagccctactgccaataaagggaaaataagagatgctcatcgacgaattatgcttttaaatcatcctgacaaaggaggctctccttatatagcagccaaaatcaatgaagctaaagatttactagaaggtcaagctaaaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear transport factor 2-like export factor 2 - ADP-ribosylation factor interacting protein 2 - synaptonemal complex central element protein 1 - progestin and adipoQ receptor family member IV |