PTXBC009702
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC009702 |
Product type: | DNA & cDNA |
Ncbi symbol: | DNAJC19 |
Origin species: | Human |
Product name: | DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene |
Size: | 2ug |
Accessions: | BC009702 |
Gene id: | 131118 |
Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 19 |
Synonyms: | PAM18; TIM14; TIMM14; mitochondrial import inner membrane translocase subunit TIM14; DnaJ (Hsp40) homolog, subfamily C, member 19; DnaJ-like protein subfamily C member 19; homolog of yeast TIM14; DnaJ heat shock protein family (Hsp40) member C19 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggccagtacagtggtagcagttggactgaccattgctgctgcaggatttgcaggccgttacgttttgcaagccatgaagcatatggagcctcaagtaaaacaagtttttcaaagcctaccaaaatctgccttcagtggtggctattatagaggtgggtttgaacccaaaatgacaaaacgggaagcagcattaatactaggtgtaagccctactgccaataaagggaaaataagagatgctcatcgacgaattatgcttttaaatcatcctgacaaaggaggctctccttatatagcagccaaaatcaatgaagctaaagatttactagaaggtcaagctaaaaaatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - nuclear transport factor 2-like export factor 2 - ADP-ribosylation factor interacting protein 2 - synaptonemal complex central element protein 1 - progestin and adipoQ receptor family member IV |