> >>DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene
DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene View larger

DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene

PTXBC009702

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009702
Product type: DNA & cDNA
Ncbi symbol: DNAJC19
Origin species: Human
Product name: DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene
Size: 2ug
Accessions: BC009702
Gene id: 131118
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 19
Synonyms: PAM18; TIM14; TIMM14; mitochondrial import inner membrane translocase subunit TIM14; DnaJ (Hsp40) homolog, subfamily C, member 19; DnaJ-like protein subfamily C member 19; homolog of yeast TIM14; DnaJ heat shock protein family (Hsp40) member C19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagtacagtggtagcagttggactgaccattgctgctgcaggatttgcaggccgttacgttttgcaagccatgaagcatatggagcctcaagtaaaacaagtttttcaaagcctaccaaaatctgccttcagtggtggctattatagaggtgggtttgaacccaaaatgacaaaacgggaagcagcattaatactaggtgtaagccctactgccaataaagggaaaataagagatgctcatcgacgaattatgcttttaaatcatcctgacaaaggaggctctccttatatagcagccaaaatcaatgaagctaaagatttactagaaggtcaagctaaaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear transport factor 2-like export factor 2
- ADP-ribosylation factor interacting protein 2
- synaptonemal complex central element protein 1
- progestin and adipoQ receptor family member IV

Reviews

Buy DNAJC19-DnaJ (Hsp40) homolog, subfamily C, member 19 Gene now

Add to cart