Cart 5 Product Products 851,75 € (empty)
-
-
1 x FANCL-Fanc...121,50 € -
1 x TERF1-telo...121,50 € -
-
No products
To be determined Shipping
851,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 851,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 851,75 €
View larger 
Data sheet of PAQR4-progestin and adipoQ receptor family member IV Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PAQR4-progestin and adipoQ receptor family member IV Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033703 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PAQR4 |
| Origin species: | Human |
| Product name: | PAQR4-progestin and adipoQ receptor family member IV Gene |
| Size: | 2ug |
| Accessions: | BC033703 |
| Gene id: | 124222 |
| Gene description: | progestin and adipoQ receptor family member IV |
| Synonyms: | progestin and adipoQ receptor family member 4; progestin and adipoQ receptor family member IV |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgttcctggccgggccgcgcctgctggactgggccagctcgccgccgcacctgcagttcaataagttcgtgctgaccgggtaccggcccgccagcagcggctcgggctgcctgcgcagcctcttctacctgcacaacgaactgggcaacatctacacgcacgggctggccctgctgggcttcctggtgctggtgccaatgaccatgccctggggtcagctgggcaaggatggctggctgggaggcacacattgcgtggcctgccttgcaccccctgcaggctccgtgctctatcacctctttatgtgccaccaagggggcagcgctgtgtacgcccggctcctcgccctggacatgtgtggggtctgccttgtcaacacccttggggccctgcccatcatccactgcaccctggcctgcaggccctggctgcgcccggctgccctggtgggctacactgtgttgtcgggtgtggccggctggcgtgctctcaccgccccctccaccagtgctcggctccgggcatttggatggcaggctgctgcccgcctactggtatttggggcccggggagtgggtctgggttcaggggctccaggctccctgccctgctacctgcgcatggacgcactggcgctgcttgggggactggtaaatgtagcccgtctgcccgagcgctggggacctggccgctttgactactggggcaactcccaccagatcatgcacctgctgagcgtgggctccatcctgcagctgcacgccggcgtcgtgcccgacctgctctgggctgcccaccacgcctgtccccgggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neurotrophic tyrosine kinase, receptor, type 3 - cell division cycle 23 homolog (S. cerevisiae) - DnaJ (Hsp40) homolog, subfamily C, member 16 - acyl-CoA synthetase long-chain family member 6 |