TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene View larger

TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene

PTXBC034247

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034247
Product type: DNA & cDNA
Ncbi symbol: TOMM5
Origin species: Human
Product name: TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene
Size: 2ug
Accessions: BC034247
Gene id: 401505
Gene description: translocase of outer mitochondrial membrane 5 homolog (yeast)
Synonyms: C9orf105; Tom5; bA613M10.3; mitochondrial import receptor subunit TOM5 homolog; mitochondrial outer membrane protein TOM5; translocase of outer mitochondrial membrane 5 homolog; translocase of outer mitochondrial membrane 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccggattgagggcctcgcgccgaagctggacccggaggagatgaaacggaagatgcgcgaggatgtgatctcctccatacggaactttctcatctacgtggccctcctgcgagtcactccatttatcttaaagaaattggacagcatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - similar to proteaseome (prosome, macropain) 28 subunit, 3
- carcinoembryonic antigen-related cell adhesion molecule 21
- protein phosphatase 2, regulatory subunit B', delta isoform
- programmed cell death 4 (neoplastic transformation inhibitor)

Buy TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene now

Add to cart