Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene
PTXBC034247
New product
Data sheet of TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034247 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TOMM5 |
| Origin species: | Human |
| Product name: | TOMM5-translocase of outer mitochondrial membrane 5 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC034247 |
| Gene id: | 401505 |
| Gene description: | translocase of outer mitochondrial membrane 5 homolog (yeast) |
| Synonyms: | C9orf105; Tom5; bA613M10.3; mitochondrial import receptor subunit TOM5 homolog; mitochondrial outer membrane protein TOM5; translocase of outer mitochondrial membrane 5 homolog; translocase of outer mitochondrial membrane 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttccggattgagggcctcgcgccgaagctggacccggaggagatgaaacggaagatgcgcgaggatgtgatctcctccatacggaactttctcatctacgtggccctcctgcgagtcactccatttatcttaaagaaattggacagcatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to proteaseome (prosome, macropain) 28 subunit, 3 - carcinoembryonic antigen-related cell adhesion molecule 21 - protein phosphatase 2, regulatory subunit B', delta isoform - programmed cell death 4 (neoplastic transformation inhibitor) |