Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CEACAM21-carcinoembryonic antigen-related cell adhesion molecule 21 Gene
PTXBC012001
New product
Data sheet of CEACAM21-carcinoembryonic antigen-related cell adhesion molecule 21 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CEACAM21-carcinoembryonic antigen-related cell adhesion molecule 21 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012001 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CEACAM21 |
| Origin species: | Human |
| Product name: | CEACAM21-carcinoembryonic antigen-related cell adhesion molecule 21 Gene |
| Size: | 2ug |
| Accessions: | BC012001 |
| Gene id: | 90273 |
| Gene description: | carcinoembryonic antigen-related cell adhesion molecule 21 |
| Synonyms: | CEACAM3; R29124_1; carcinoembryonic antigen-related cell adhesion molecule 21; carcinoembryonic antigen related cell adhesion molecule 21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcccccctcagcttgtccccacagagaatgcatcccctggcaggggctcttgctcacagcctcacttttaactttctggaacgcacccaccactgcctggctctttattgcatcagcgccctttgaagttgctgaaggggagaatgttcatctctctgtggtttatctgcccgagaatctttacagctatggctggtacaaagggaaaacggtggagcccaaccagctaatcgcagcatatgtaatagacactcacgttaggactccagggcctgcatacagcggtcgagagacaatatcacccagtggagatctgcatttccagaacgtcaccctagaggacacgggatactacaacctacaagtcacatacagaaattctcagattgaacaggcatctcaccatctccgtgtatacggagaatgttctaaatttgactctgagatctctgaggatgcagcatggccccaagacactttctgttggtcactctatccacagagtcagtggctcagccctccatccaagccagcagcaccacagtcacagagaagggctccgtggtcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2, regulatory subunit B', delta isoform - programmed cell death 4 (neoplastic transformation inhibitor) - solute carrier family 27 (fatty acid transporter), member 6 - nudix (nucleoside diphosphate linked moiety X)-type motif 12 |