Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene
PTXBC010502
New product
Data sheet of KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010502 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRAS |
| Origin species: | Human |
| Product name: | KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene |
| Size: | 2ug |
| Accessions: | BC010502 |
| Gene id: | 3845 |
| Gene description: | v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog |
| Synonyms: | KRAS proto-oncogene, GTPase; GTPase KRas; C-K-RAS; CFC2; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; KI-RAS; KRAS1; KRAS2; NS3; RALD; RASK2; c-Ki-ras2; K-Ras 2; K-ras p21 protein; Kirsten rat sarcoma viral oncogene homolog; PR310 c-K-ras oncogene; c-Ki-ras; c-Kirsten-ras protein; cellular c-Ki-ras2 proto-oncogene; cellular transforming proto-oncogene; oncogene KRAS2; transforming protein p21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagtggcgccatctcagctcactgcaacctccatctcccaggttcaagcgattctcgtgcctcggcctcctgagtagctgggattacaggcgtgtgccactacactcaactaatttttgtatttttaggagagacggggtttcaccctgttggccaggctggtctcgaactcctgacctcaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fatty acid binding protein 5 (psoriasis-associated) - uncoupling protein 2 (mitochondrial, proton carrier) - calcium channel, voltage-dependent, beta 1 subunit - ring finger and CHY zinc finger domain containing 1 |