DPH5-DPH5 homolog (S. cerevisiae) Gene View larger

DPH5-DPH5 homolog (S. cerevisiae) Gene

PTXBC009620

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPH5-DPH5 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DPH5-DPH5 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009620
Product type: DNA & cDNA
Ncbi symbol: DPH5
Origin species: Human
Product name: DPH5-DPH5 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC009620
Gene id: 51611
Gene description: DPH5 homolog (S. cerevisiae)
Synonyms: DPH5 homolog; AD-018; CGI-30; HSPC143; NPD015; diphthine methyl ester synthase; diphthamide biosynthesis methyltransferase; diphthine synthase; protein x 0011; diphthamide biosynthesis 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcactgtggacttgggagaaccattgcattccttgatcatcacaggaggcagcatacatccaatggagatggagatgctaagtctgttttccataccagaaaatagctcagaatctcaaagcatcaatggactttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thymic stromal lymphopoietin
- nescient helix loop helix 1
- transmembrane protein 148
- transmembrane protein 14B

Buy DPH5-DPH5 homolog (S. cerevisiae) Gene now

Add to cart