Cart 34 Product Products 6 084,25 € (empty)
-
1 x BXDC1-brix...121,50 € -
1 x NAT1-N-ace...121,50 € -
-
1 x C15orf50-c...113,40 € -
1 x ZNF436-zin...121,50 € -
1 x IGKC-immun...113,40 € -
-
1 x ASB6-ankyr...121,50 € -
-
1 x C1QTNF3-C1...121,50 € -
-
1 x TP53-tumor...121,50 € -
1 x CSNK1D-cas...121,50 € -
-
-
1 x CNIH3-corn...113,40 € -
1 x TUBAL3-tub...121,50 € -
1 x KIAA0999-K...121,50 € -
1 x RPS27L-rib...113,40 € -
-
-
1 x HIST2H2AC-...113,40 € -
1 x CLEC11A-C-...121,50 € -
-
-
-
1 x GRN-granul...121,50 € -
1 x B4GALT7-xy...121,50 € -
-
1 x PRPS2-phos...121,50 € -
1 x SLIT1-slit...113,40 € -
-
1 x SLC45A2-so...113,40 € -
1 x NDUFS8-NAD...113,40 €
No products
To be determined Shipping
6 084,25 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 34 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 084,25 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 084,25 €
Data sheet of TSLP-thymic stromal lymphopoietin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSLP-thymic stromal lymphopoietin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016720 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSLP |
| Origin species: | Human |
| Product name: | TSLP-thymic stromal lymphopoietin Gene |
| Size: | 2ug |
| Accessions: | BC016720 |
| Gene id: | 85480 |
| Gene description: | thymic stromal lymphopoietin |
| Synonyms: | thymic stromal lymphopoietin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaaactaaggctgccttagctatctggtgcccaggctattcggaaactcagataaatgctactcaggcaatgaagaagaggagaaaaaggaaagtcacaaccaataaatgtctggaacaagtgtcacaattacaaggattgtggcgtcgcttcaatcgacctttactgaaacaacagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nescient helix loop helix 1 - transmembrane protein 148 - transmembrane protein 14B - histone cluster 1, H2ac |