PXMP2-peroxisomal membrane protein 2, 22kDa Gene View larger

PXMP2-peroxisomal membrane protein 2, 22kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PXMP2-peroxisomal membrane protein 2, 22kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PXMP2-peroxisomal membrane protein 2, 22kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009836
Product type: DNA & cDNA
Ncbi symbol: PXMP2
Origin species: Human
Product name: PXMP2-peroxisomal membrane protein 2, 22kDa Gene
Size: 2ug
Accessions: BC009836
Gene id: 5827
Gene description: peroxisomal membrane protein 2, 22kDa
Synonyms: PMP22; peroxisomal membrane protein 2; 22 kDa peroxisomal membrane protein; peroxisomal membrane protein 2, 22kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgatgaactgtagtggcgtccacacccgccagttcatcctcagcgccggccagaagccccccctcatcttggcggcgaaggctgaggcgtctttcccctccagaaagttcatgatgaggaagaacaacatgaggaaggccggtgcaaagacgaggcggtccaggagaagcctcctgagccctgccagggggacctcaggagggatccaatgttccatgaagaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane 6 superfamily member 1
- CD300 molecule-like family member b
- solute carrier family 35, member B1
- secretory carrier membrane protein 3

Buy PXMP2-peroxisomal membrane protein 2, 22kDa Gene now

Add to cart